ID: 1183125777

View in Genome Browser
Species Human (GRCh38)
Location 22:35780187-35780209
Sequence CTCTGGCCTTCTCTTTAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183125777 Original CRISPR CTCTGGCCTTCTCTTTAGTG CGG Intronic
900589685 1:3454164-3454186 CTCTGGCCACCTTTTTGGTGTGG - Intergenic
901310296 1:8264310-8264332 CTGTGCCCTTCTCTGTAATGTGG + Intergenic
903544300 1:24113928-24113950 CTCTCTCCTTCTCTCGAGTGAGG - Intergenic
906020533 1:42625009-42625031 TTCTGGCCTTTTCTTTACTGGGG + Intronic
907976532 1:59436280-59436302 CTCTGCCCTTCTGTTTCATGGGG + Intronic
908598003 1:65709002-65709024 ATCTGCCCTTCTCTTTTGTGTGG + Intergenic
910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG + Intergenic
911088249 1:93997729-93997751 CTCTTGCCCTCTGTTTATTGGGG - Intronic
912570946 1:110620511-110620533 CTCTGGCCTTCTGCCAAGTGGGG - Intronic
913038463 1:114999091-114999113 CTCTGTCTCTCTCTTGAGTGTGG + Intergenic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
915526261 1:156478162-156478184 CTCTGGCCTTCTCCTTGAAGAGG + Intronic
917226335 1:172788045-172788067 CTGTGTCCTTCTCTTCAGAGTGG + Intergenic
917373005 1:174316720-174316742 CTGTGTCCTTCCCTTTAGGGTGG + Intronic
917524959 1:175780377-175780399 CTCTTGCCTTCTCCATGGTGAGG + Intergenic
918522014 1:185425007-185425029 CTGTGCTCTTCTCTTTAATGTGG - Intergenic
918996690 1:191771143-191771165 CTCTGGCCTTCTCTATCTTTTGG + Intergenic
920800293 1:209181359-209181381 CTATGGCCTTATATATAGTGTGG - Intergenic
923854666 1:237833227-237833249 CTTTAGTCTTTTCTTTAGTGGGG + Exonic
923886535 1:238164135-238164157 CTGTGTCCTTCTTTTTAGGGTGG + Intergenic
924358370 1:243208805-243208827 CTGTAGCCTACACTTTAGTGGGG - Intronic
1066186671 10:33016201-33016223 CTCTAGCCTTCTCTTGAGGCAGG + Intergenic
1066524310 10:36259610-36259632 CTTTGACCTTTTTTTTAGTGGGG + Intergenic
1067575117 10:47404035-47404057 CTCTGGCCTTCTCTATGGGAGGG + Intergenic
1068411309 10:56659791-56659813 CTTTGTCCTTCTCTTCAGGGTGG + Intergenic
1071256411 10:83875806-83875828 CTCTGTCCTTCCCTTGAGTTTGG + Intergenic
1072282021 10:93874553-93874575 CTCTGGAGTTGTCTTTAATGGGG - Intergenic
1072673180 10:97446417-97446439 CTGGGGCCTTGTCTTGAGTGCGG + Intronic
1072796056 10:98355425-98355447 CTCTGGCTTTCACTATAGGGTGG + Intergenic
1074050012 10:109873095-109873117 CTTTGGCCTTCTCTTGAGTCAGG - Intronic
1074097094 10:110323528-110323550 CTGTGGCCTTCCCTTCAGAGTGG - Intergenic
1075679506 10:124322385-124322407 TTCTGCCCTTCTCTTTGGTACGG - Intergenic
1077284566 11:1759922-1759944 CTCTGGCCTTGTCTTTTCCGTGG - Intronic
1079313102 11:19383550-19383572 CTCTCAGCTTCTCTTTACTGTGG - Intronic
1079449140 11:20584287-20584309 CTCTGTGCTGCTGTTTAGTGGGG - Intergenic
1080929383 11:36792331-36792353 ATCAGGCCTTCTCTTTATTTTGG - Intergenic
1081105603 11:39064876-39064898 CTCTGGCTTTCATTATAGTGAGG + Intergenic
1081411497 11:42763875-42763897 TTCTAGTCTTCTGTTTAGTGGGG - Intergenic
1084938664 11:72600823-72600845 ATCTGTCCTTATCTTCAGTGGGG - Intronic
1085008109 11:73114001-73114023 CTCTGTCCTTCCCTTTAGGGTGG + Intronic
1086728361 11:90218703-90218725 CCCTAGTCTTCTTTTTAGTGAGG - Intronic
1089247457 11:117132702-117132724 CTCTGGACTTGTCTTTATTGGGG - Intergenic
1090612685 11:128485566-128485588 CTCAGGCCATCTCTTCAGTATGG + Intronic
1093123947 12:15306522-15306544 CTGTGTCCTTCCCTTCAGTGTGG + Intronic
1094125968 12:27022645-27022667 CTCTGTCTTTCTCTTTCTTGAGG + Intronic
1095133726 12:38572522-38572544 CTGTGTCCTTCCCTTTAGTGTGG - Intergenic
1096978846 12:55716927-55716949 CTCTCGCCTCCTCTTTTCTGGGG - Exonic
1096986443 12:55761926-55761948 AACTGTCCTGCTCTTTAGTGAGG - Intronic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1100923883 12:99521949-99521971 CTGTGTCCTTCCCTTTAGGGCGG + Intronic
1101224942 12:102678816-102678838 CTCTAGCCCTCTCTTTATTCAGG + Intergenic
1102140447 12:110610661-110610683 CTCTGTCTTGCTCTTTGGTGTGG - Intergenic
1105411329 13:20174123-20174145 CTCTGCCCTCCTCTCCAGTGTGG - Intergenic
1106963986 13:35037912-35037934 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
1109082735 13:57927061-57927083 TTCTGGGCTTCTCATTAATGAGG - Intergenic
1109656295 13:65395279-65395301 TTCTAGCCTTCTCCTTAGTTGGG + Intergenic
1111108920 13:83682192-83682214 CTCTGGCATTCTCTTATATGAGG - Intergenic
1111224759 13:85254638-85254660 CTGTGGCCTTGTCAATAGTGAGG + Intergenic
1114072585 14:19126571-19126593 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1114089671 14:19273401-19273423 CTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1114859141 14:26493705-26493727 ATCTGGCCTTTCCTTTAGAGGGG + Intronic
1116057955 14:39886450-39886472 CTGTGCCCTTCCCTTTAGGGTGG - Intergenic
1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG + Intergenic
1122543007 14:102508295-102508317 CCCTGGCCTTTTCTTTATTTGGG - Intronic
1124823885 15:33074291-33074313 CTCTGGCTTTTTCTTTTGTTTGG - Intronic
1124853171 15:33360839-33360861 ATCTGGCCTATGCTTTAGTGTGG + Intronic
1125600780 15:40914866-40914888 GGCTTGCCTTCTCTCTAGTGGGG - Intergenic
1125910123 15:43429877-43429899 GACTGACTTTCTCTTTAGTGCGG - Intronic
1126258130 15:46652460-46652482 CCCTGGCCTTCTGTTTAATGGGG - Intergenic
1126852695 15:52806568-52806590 ATCTGGCCTTCTCTAGAGGGAGG - Intergenic
1126926380 15:53592143-53592165 CTGGGGCTTTCTCTCTAGTGTGG - Intronic
1127022254 15:54760889-54760911 CACAGTCCTTCCCTTTAGTGTGG - Intergenic
1127173563 15:56328860-56328882 GTCTGTCCTTCTCTTCAGGGTGG - Intronic
1128285913 15:66436944-66436966 CTCTGGCCTAATCTTTGGTCTGG + Intronic
1128354721 15:66917559-66917581 CTTTGGCATTGCCTTTAGTGAGG - Intergenic
1129880729 15:79004531-79004553 CTCTGGCCTCATCCTTAGAGAGG + Intronic
1129943604 15:79519989-79520011 CTCTGCCATTGTCTTGAGTGGGG + Intergenic
1130847798 15:87763524-87763546 CTCTTGCCTTGTCTTGAGAGTGG - Intergenic
1131441445 15:92462659-92462681 TGCTGGCCTTCACTTTAGTTAGG + Intronic
1137620730 16:49875096-49875118 CTCTTGCCTTCTCTGTAAAGTGG - Intergenic
1137688722 16:50404981-50405003 CTCTGGCCATCTCTTTGAAGTGG - Intergenic
1139007979 16:62596779-62596801 CTCTGGCTTTCCCCTTAGTAAGG + Intergenic
1139218824 16:65157973-65157995 CTCAAGGCTTCTCTTAAGTGGGG - Intergenic
1142905951 17:3041925-3041947 CTCTGGCCGTCTCTTCAATGAGG + Intergenic
1144642820 17:16947518-16947540 CTTTTGCCTACTTTTTAGTGGGG - Intronic
1148193704 17:45698304-45698326 CTCTAGCCTTCTCTTTGGCATGG + Intergenic
1148867805 17:50638140-50638162 CTCTGGCCTCCTGAGTAGTGAGG - Intronic
1152329090 17:79660463-79660485 CTCTTGCCTACTTTTTAATGGGG - Intergenic
1152673657 17:81625001-81625023 CTCTAGCTTCCTCTTCAGTGTGG - Intronic
1155852128 18:30787060-30787082 CTTTGGCCTACTTTTTAATGTGG + Intergenic
1156670899 18:39468152-39468174 CTCTTTCTGTCTCTTTAGTGGGG - Intergenic
1157079404 18:44506503-44506525 CTCTGTCATTCTCTTCAGTTGGG - Intergenic
1158155739 18:54423550-54423572 CTGTGTCTTTCTCTTTATTGGGG - Intergenic
1158252681 18:55507155-55507177 GCCTGGCCTTTTCTTAAGTGGGG + Intronic
1163426470 19:17243548-17243570 CTCTGGTCATATCTTTAGGGAGG - Intronic
1163458942 19:17424875-17424897 CTTTGGCCCTCTCTTTACTCTGG + Intronic
1165142310 19:33707101-33707123 CTCTGACCTGCACTTTAGTCTGG - Intronic
1202671710 1_KI270709v1_random:60374-60396 GTCTGGCCTTCACTTTAGCCTGG + Intergenic
926945510 2:18183527-18183549 CTCTGCCTTTCTCTGCAGTGAGG - Intronic
927494157 2:23541323-23541345 CTCTGGCCTTCTCCATAGCTAGG - Intronic
927731560 2:25477756-25477778 CTATGGGCTTCTCTTTTGGGTGG - Intronic
928560295 2:32476460-32476482 CTCTGGACTTTTTTTTGGTGGGG + Intronic
928726420 2:34179082-34179104 CATTGGCCTTCCTTTTAGTGGGG + Intergenic
928802984 2:35116257-35116279 CTGTGTCCTTTTCTTTAGGGTGG - Intergenic
928851934 2:35758988-35759010 CTGTGTCCTTCTTTTTAGAGTGG + Intergenic
929117624 2:38457475-38457497 CTATGGCCATCTCTTTAGCCTGG - Intergenic
929560734 2:42954796-42954818 CTCTGGGCGTCTCATTAGCGTGG + Intergenic
930230387 2:48837283-48837305 TTCTGGGCTTTTCTTTACTGGGG + Intergenic
930733211 2:54748550-54748572 CCCTGGACTTCTTTTTATTGGGG + Intronic
931650234 2:64462044-64462066 CTCTTGCCTTCTCTTTCCTGTGG + Intergenic
936459154 2:112699032-112699054 CTCTTGCCTACTTTTTAATGGGG + Intergenic
936925424 2:117731519-117731541 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
937036142 2:118784151-118784173 CCCTGGCCTTCCCTTTAGCCAGG - Intergenic
938486824 2:131720044-131720066 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
939118199 2:138085721-138085743 CTTTGGCCTACTTTTTAATGGGG + Intergenic
940327754 2:152443296-152443318 CACTAGCCTTCACTTCAGTGGGG + Intronic
944508672 2:200442544-200442566 CTCTGTCTTACTCTTTAGTGTGG + Intronic
945041950 2:205749789-205749811 CTGTGGCCTCCTCTTCGGTGGGG - Exonic
946936634 2:224728597-224728619 CTTTTTCCTTCTCTGTAGTGGGG - Intergenic
947114104 2:226750733-226750755 CTCTGTGCTTTTCTTTAGTATGG - Intronic
947847249 2:233254550-233254572 CTCCAGCCTTCTCTTCAGGGAGG + Intronic
948493050 2:238326283-238326305 CTCTGGCTTTCTCCTTTCTGAGG + Intronic
1170192690 20:13659712-13659734 ATCTTTGCTTCTCTTTAGTGTGG - Intergenic
1171313325 20:24164474-24164496 CTGTGGGATTCTCTTTATTGTGG + Intergenic
1172889248 20:38252495-38252517 CTCTGTCTTTCTCTTCTGTGCGG - Intronic
1172987802 20:39006980-39007002 CTCTGCACTTCTCTTCTGTGGGG + Intronic
1173051381 20:39565376-39565398 CTCTGGCCATCTTTTTCTTGTGG + Intergenic
1173354864 20:42277729-42277751 GGCTGGCCTTCTTGTTAGTGGGG + Intronic
1175129851 20:56780932-56780954 CCCTGGCCTTCTTTTGAATGAGG + Intergenic
1176145702 20:63564510-63564532 CACTGGCCTTCTCCATGGTGAGG + Exonic
1178083718 21:29092315-29092337 CTCTTGCCTCCTCTTTAGAGAGG - Intronic
1179568821 21:42265841-42265863 CCCTGGCCTCCCCCTTAGTGAGG + Intronic
1179591741 21:42413552-42413574 CTTTGGTCTTCTCTTTAGGCGGG + Intronic
1180491033 22:15848946-15848968 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1182138517 22:27930920-27930942 CCCTGCCCTTCTTTTTATTGTGG + Intergenic
1183125777 22:35780187-35780209 CTCTGGCCTTCTCTTTAGTGCGG + Intronic
1184339600 22:43879069-43879091 CTCTGGCCATCTCCTGGGTGGGG - Intergenic
1184973994 22:48047889-48047911 CTCTGGCTTTGTCTTTAGCATGG - Intergenic
951025466 3:17824110-17824132 CTTTGGCCTTTTCTCTAGTGAGG + Intronic
952232465 3:31446141-31446163 ATCTAGCCTTCTCTTTACTAGGG + Intergenic
953187450 3:40652026-40652048 CTCTGGCCTTGTCTCCAGTCTGG + Intergenic
953470965 3:43165719-43165741 TTTTGGCCTGCTCTTTAGTGTGG - Intergenic
953477860 3:43221255-43221277 CTCTGGCCTCAGCTTTAATGAGG - Intergenic
954435424 3:50493392-50493414 CTCTGGGTTTCTCTTAAGAGGGG - Intronic
954541680 3:51397216-51397238 CTATGGTCTTCTATTTATTGTGG + Exonic
956881873 3:73519249-73519271 CTCTGGCCTCCTCTTTACGCTGG - Intronic
959181313 3:102984159-102984181 CTTTTGCCTGCTCTTTAGTGGGG - Intergenic
962061196 3:131929472-131929494 CTTTGGGCTTCTCTTTTGTTGGG + Intronic
962890432 3:139667549-139667571 CTCTAGGTTTCTCTTTACTGAGG + Intronic
964702275 3:159581618-159581640 CTCTCCCCTTCTCTGTAGAGGGG - Intronic
965080234 3:164023894-164023916 CCCTGGCCTTGTTTTAAGTGTGG - Intergenic
965930082 3:174031340-174031362 CTCTGGGCTTCTCTTTAGGATGG - Intronic
967123816 3:186407162-186407184 CTCGGCCCTTCTCTTCAGGGAGG - Intergenic
969437271 4:7195227-7195249 ATGTTGGCTTCTCTTTAGTGAGG + Intronic
971825104 4:31611049-31611071 CTCTAGCCATCTTGTTAGTGAGG + Intergenic
971829715 4:31674916-31674938 CTCTGCCCTTCTCTGAGGTGGGG - Intergenic
971891540 4:32529816-32529838 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
976016501 4:80560891-80560913 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
976269700 4:83218572-83218594 CTCTGTCCTTCTCTCTGGAGGGG + Intergenic
977607530 4:98996873-98996895 ATCAGGCCTTCTCTTTATTCCGG - Intronic
977654792 4:99508315-99508337 TTATCGCCTTCTCTTGAGTGTGG - Intergenic
978122305 4:105094473-105094495 TTCTGGCCTTCTCCATAGTCTGG - Intergenic
980960480 4:139470117-139470139 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
981251138 4:142602531-142602553 CTCTGGCCTGCTTTTTAATGGGG - Intronic
983347150 4:166541771-166541793 CTCAGGACTTCTGGTTAGTGAGG - Intergenic
986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG + Intergenic
986899280 5:12412482-12412504 CTCTGTCCTTCTTTTCAGGGTGG + Intergenic
987849071 5:23325463-23325485 CTCAGGCTTTCTCTTTATTCTGG - Intergenic
990930957 5:61091491-61091513 CTTTGGCCTACTTTTTAATGGGG + Intronic
991571176 5:68054861-68054883 CTCTAGCCTGCTCTTAACTGTGG - Intergenic
992309641 5:75482450-75482472 CTATGTCCTTCCCTTTAGGGTGG - Intronic
992345273 5:75869584-75869606 CTTTGTCCTTCTCTTCAGGGTGG - Intergenic
996270541 5:121599106-121599128 CTTTTGCCCTCTCTTTAATGTGG + Intergenic
996582628 5:125048455-125048477 CTCTAGGTTTCTCTTTACTGTGG - Intergenic
997358908 5:133281928-133281950 CTCTGGCCTGGTCTCTAGTCTGG - Intronic
997832740 5:137164995-137165017 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
998083650 5:139297871-139297893 ATCTGACATTCTCTTTAATGTGG + Intronic
998897338 5:146813950-146813972 CTCCTGCCTTCTCCTGAGTGTGG - Intronic
1000925279 5:167186439-167186461 CTCCGGTCTTCCCTTTGGTGAGG + Intergenic
1002490418 5:179572285-179572307 CTCTGGACTTCACTTTTCTGTGG + Intronic
1003044281 6:2718621-2718643 CTCTGGACTTCTTTATTGTGAGG + Intronic
1007372996 6:41439056-41439078 CTCTGGCCTCCTCTGTAGCTAGG - Intergenic
1012714355 6:102649447-102649469 CTGTGTCCTTCTCTTTAGTGTGG - Intergenic
1012971459 6:105736046-105736068 CTCTGGACCTCTGTTTAGAGAGG - Intergenic
1013278813 6:108614849-108614871 TTCTTGCCTTCTCTTGAGTTAGG + Intronic
1013895102 6:115078644-115078666 CTCTAGCCTTCCCTTAAGAGGGG + Intergenic
1014865175 6:126520824-126520846 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1015257431 6:131195120-131195142 TTCTTGCCTTTTTTTTAGTGAGG + Intronic
1016231002 6:141803933-141803955 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1017276126 6:152570816-152570838 GTTTGTCTTTCTCTTTAGTGAGG - Intronic
1017424030 6:154302471-154302493 TTCTTTTCTTCTCTTTAGTGGGG + Intronic
1018177780 6:161192674-161192696 CTTTAGCATTTTCTTTAGTGAGG + Intronic
1019525913 7:1480404-1480426 CTCTGGGCTGCTCTTTGGTTTGG + Exonic
1021077447 7:16322389-16322411 CTTAGGCCTTCTCATTTGTGTGG - Intronic
1022348335 7:29539652-29539674 CTGTGCCCTTCCCTTTAGCGTGG - Intergenic
1022503004 7:30894276-30894298 TGCTGGCCTCCTCTTTTGTGAGG + Intergenic
1025812626 7:64884824-64884846 CTCGGGCCGTCTCATTAGTCGGG - Intronic
1027188940 7:75986988-75987010 CTCTGGGCCTCTCTTTATTGAGG + Exonic
1030903929 7:115159616-115159638 CTCTGTCTTTCCCTTTAGAGAGG + Intergenic
1033486709 7:141796798-141796820 CTAAGGCCTTCTCTTTAATTGGG - Intergenic
1035990952 8:4489589-4489611 GTCATACCTTCTCTTTAGTGTGG + Intronic
1037154618 8:15684707-15684729 CTGTGGCCTTAGCTTGAGTGGGG - Intronic
1037536516 8:19829426-19829448 CTGTAGCCTTCTCTTTTCTGTGG + Intronic
1039246005 8:35609231-35609253 CTTTGCCCAACTCTTTAGTGGGG + Intronic
1042564663 8:70099999-70100021 CTGTGGACTTCTCTTTCTTGGGG + Intergenic
1044062744 8:87659737-87659759 CCCTCGCCTTCTCTTTAGTTGGG - Intergenic
1045341617 8:101260027-101260049 CTCTAGTCCTTTCTTTAGTGAGG - Intergenic
1045472603 8:102525735-102525757 CTCTGGCCTTCTCTGACTTGTGG - Intergenic
1046045764 8:108962724-108962746 CTCTGGCCTCAACTTGAGTGAGG - Intergenic
1047413105 8:124640387-124640409 CCAAGGCCTTCTCTTTAGAGTGG + Intronic
1049257057 8:141619797-141619819 CTCTGGCCCTCTCTTGGGAGGGG - Intergenic
1051040350 9:12802177-12802199 CTCAGGCCTATTCTTTAGTGTGG - Intronic
1055378377 9:75676817-75676839 CTCTGGCATTCTCTTTTGATTGG - Intergenic
1056534506 9:87516156-87516178 TTCTGCCCTTCTCCTTGGTGTGG + Intronic
1056992702 9:91425219-91425241 CTCTGCTCTTCTCTTTACTTTGG - Intergenic
1057843142 9:98502317-98502339 CTGTGGCCTTCTCAGAAGTGGGG - Intronic
1059463367 9:114449510-114449532 CTCTGGCCTGGTCTTTACAGCGG - Intronic
1061195021 9:129102834-129102856 CTCTGGGGTCCTCTTTAGTTGGG + Intronic
1061200991 9:129138470-129138492 CTCTGGACCTCTCTTGAGGGAGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062167053 9:135113142-135113164 CTCTGGGCCTCTCTGAAGTGGGG + Intronic
1189065719 X:37806194-37806216 CTCTGGCCTTCACTCTAGCAGGG - Intronic
1191150749 X:57219384-57219406 CTGTGGCCTGCTCTTTGGGGTGG - Intergenic
1193690976 X:84642216-84642238 CTTTGGCCCACTCTTTAATGGGG - Intergenic
1193861837 X:86677760-86677782 CCCTGGCCTTTTCTTCAGTGAGG - Intronic
1194290997 X:92071900-92071922 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1194495515 X:94612865-94612887 CTCTGTACTTCTCATTAGGGTGG + Intergenic
1196982077 X:121225798-121225820 CCCTTGCCTACTCTTTAATGAGG + Intergenic
1197614881 X:128679951-128679973 CTCTGCGTTTCTCTTTATTGGGG - Intergenic
1198862343 X:141084419-141084441 CTCTGCCCTTCTGATCAGTGAGG + Intergenic
1198900351 X:141502967-141502989 CTCTGCCCTTCTGATCAGTGAGG - Intergenic
1199528771 X:148823823-148823845 CTCTGGTCTTCTCTCTTTTGTGG - Intronic
1200608506 Y:5296475-5296497 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1201765595 Y:17571152-17571174 CCTAGGCCTTTTCTTTAGTGGGG - Intergenic
1201835957 Y:18334837-18334859 CCTAGGCCTTTTCTTTAGTGGGG + Intergenic