ID: 1183126325

View in Genome Browser
Species Human (GRCh38)
Location 22:35784879-35784901
Sequence CTCAAACCCTGCCACCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183126325_1183126335 30 Left 1183126325 22:35784879-35784901 CCAGGGCGGTGGCAGGGTTTGAG 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1183126335 22:35784932-35784954 AGAGGGCGCGATCCCACTCCAGG No data
1183126325_1183126330 12 Left 1183126325 22:35784879-35784901 CCAGGGCGGTGGCAGGGTTTGAG 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1183126330 22:35784914-35784936 GGTGGCGACCCACTCCACAGAGG 0: 1
1: 0
2: 2
3: 6
4: 89
1183126325_1183126331 13 Left 1183126325 22:35784879-35784901 CCAGGGCGGTGGCAGGGTTTGAG 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1183126331 22:35784915-35784937 GTGGCGACCCACTCCACAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1183126325_1183126327 -9 Left 1183126325 22:35784879-35784901 CCAGGGCGGTGGCAGGGTTTGAG 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1183126327 22:35784893-35784915 GGGTTTGAGGACCGTGACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1183126325_1183126328 -6 Left 1183126325 22:35784879-35784901 CCAGGGCGGTGGCAGGGTTTGAG 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1183126328 22:35784896-35784918 TTTGAGGACCGTGACAGAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183126325 Original CRISPR CTCAAACCCTGCCACCGCCC TGG (reversed) Intronic
900165933 1:1244348-1244370 CTCAGACCCTGCAGCAGCCCGGG + Intronic
900478369 1:2886793-2886815 CTCCAAGCCTCCCAGCGCCCTGG + Intergenic
900879257 1:5368816-5368838 CCCAAACCCTGCCACTGACTTGG + Intergenic
902712098 1:18247411-18247433 CTCATTCCCTGCCACCACCCAGG - Intronic
902721447 1:18306935-18306957 CTGAAAACCTGCCACCTTCCAGG + Intronic
903541625 1:24099626-24099648 CCCAGACCCTGCCACCGCCGAGG - Intronic
904379801 1:30103056-30103078 CTCACACCCTGCCTGCGGCCTGG - Intergenic
905626092 1:39491497-39491519 CGCAACACCTGCCGCCGCCCGGG + Intergenic
905665354 1:39760328-39760350 CTCAAACCCAGCCAGACCCCAGG - Exonic
905888825 1:41507316-41507338 CTCAACCCCTGCAACCCTCCAGG - Exonic
907432910 1:54424355-54424377 CTCAAACGATGCCCCCGCCTCGG + Intergenic
908521252 1:64945081-64945103 CTCAAACCCTGGCACCTGCTTGG + Intronic
908579201 1:65496337-65496359 CTCAAGCCATCCCACCGCCTTGG - Intronic
909426811 1:75535331-75535353 CACGCACCCTGCCACCACCCTGG + Intronic
912629507 1:111234473-111234495 CTCACCCCCTGCCATCCCCCAGG - Intronic
913528073 1:119712661-119712683 CCCCAACCCCGCCACCGCCAAGG - Intronic
915937820 1:160099070-160099092 CTCCAATCCTGGCTCCGCCCTGG + Intergenic
916757841 1:167790321-167790343 CTCAAACTCTGTCAGTGCCCTGG + Exonic
920422132 1:205842095-205842117 CTCAAACCTACCCACCCCCCAGG - Intronic
922109965 1:222547234-222547256 TCCAACCCCTGCCACCGCCAGGG + Intronic
922725344 1:227920412-227920434 CTCCATCCCTGCCACCTCCCCGG - Exonic
1064008913 10:11719666-11719688 GTCACGCCCTGCCACCGCCCAGG - Intergenic
1066990379 10:42507587-42507609 GTCAAACTCTGCCACCCACCTGG - Intergenic
1073214026 10:101826823-101826845 CTCAACCCCAGCCACCTCCTAGG + Intronic
1074096320 10:110316488-110316510 CTCAACCCCAGCCAACTCCCAGG + Intergenic
1076350429 10:129811497-129811519 CTCTCACTCTGCCACCGCCCTGG + Intergenic
1077035639 11:493170-493192 CTCAACCCCAGACAGCGCCCAGG + Intergenic
1077281362 11:1747639-1747661 CTTGCCCCCTGCCACCGCCCGGG + Intronic
1082943717 11:58735712-58735734 CACAAACCCTGCCACCTTCAAGG - Intergenic
1083343351 11:61973183-61973205 CCCCAACCCTGGCACAGCCCGGG + Intergenic
1085395163 11:76203483-76203505 CTCAAACCCTCCCCCTACCCAGG + Intronic
1089401103 11:118165130-118165152 CTCTAGCCCTGCCCCCTCCCAGG - Exonic
1089501398 11:118933686-118933708 CTCAGAACCTGCCATCTCCCAGG + Intronic
1090829333 11:130410067-130410089 CTCACACCTTTCCACCACCCTGG + Intronic
1092777786 12:11959385-11959407 TTCACACCCTGCCACTACCCAGG - Intergenic
1093654054 12:21674925-21674947 CCCACACCCTGCCACCTCCAGGG + Intronic
1095806275 12:46324041-46324063 CTCAAACTCTGCAACCTCCATGG - Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1101640761 12:106584435-106584457 CTCAAACCTCGCCACGGCCCAGG - Intronic
1102063182 12:109950762-109950784 TTCAAACCCTGCTCCCACCCTGG - Intronic
1103977153 12:124710567-124710589 CTTAATCCCCGCCACAGCCCAGG + Intergenic
1104469421 12:129017842-129017864 CTCATACCCACCCACAGCCCTGG + Intergenic
1104860287 12:131919861-131919883 CTCCCTCCCTGCCACAGCCCTGG - Intronic
1104998771 12:132675232-132675254 CTGCAACCCTGCCAGGGCCCGGG - Intronic
1105881863 13:24612848-24612870 CCCACACCCTTCCACCACCCAGG - Intergenic
1106077808 13:26475936-26475958 CCCAAGCCCTGCCCCCTCCCTGG - Intergenic
1113994796 14:16056873-16056895 GTCAAACCATGCCACTGGCCCGG + Intergenic
1115599014 14:34937853-34937875 ACAAAACCCAGCCACCGCCCTGG - Intergenic
1118349891 14:64966089-64966111 CTCAGACCCTGGCACTGCCAGGG + Intronic
1118906248 14:70025540-70025562 TTCAAACCCTGCCTCTGTCCCGG + Intronic
1119896046 14:78220717-78220739 TCCAAGCCCTGCCACCTCCCTGG - Intergenic
1121889615 14:97577045-97577067 CCCAAACCCTGCCACCACCCTGG - Intergenic
1122266342 14:100548682-100548704 GACAAACCCTGCCCCTGCCCCGG + Intronic
1125400676 15:39299333-39299355 GTCAGACCCTGGCACCTCCCAGG - Intergenic
1127396372 15:58546868-58546890 CTCCCAGCCTTCCACCGCCCAGG + Intronic
1128166850 15:65473080-65473102 CTCCCACCTTGCCACCTCCCAGG - Intronic
1128772420 15:70292185-70292207 CTCCAATCCTCCCACTGCCCTGG - Intergenic
1129230879 15:74196654-74196676 CTCAAACACTGCCCCAGCCAGGG + Intronic
1130132188 15:81153446-81153468 CTGTAACCCTGGCACCTCCCTGG + Intergenic
1132562741 16:605476-605498 CTCACACTCTGCCCCCGGCCTGG + Intronic
1134522331 16:14924479-14924501 CTCACTGCCTCCCACCGCCCCGG + Intronic
1134710001 16:16323130-16323152 CTCACTGCCTCCCACCGCCCCGG + Intergenic
1134717216 16:16363130-16363152 CTCACTGCCTCCCACCGCCCCGG + Intergenic
1134851573 16:17483173-17483195 CTCACACCCTTCCATCACCCTGG + Intergenic
1134949602 16:18345515-18345537 CTCACTGCCTCCCACCGCCCCGG - Intergenic
1134957535 16:18389029-18389051 CTCACTGCCTCCCACCGCCCCGG - Intergenic
1136576938 16:31130670-31130692 CTCATACCCTGTCACCATCCTGG + Intronic
1137466068 16:48710952-48710974 CTCAAACCCTCCCAGGGGCCAGG + Intergenic
1137844497 16:51673986-51674008 CTCAAACCCTGCTAACTGCCAGG - Intergenic
1140601501 16:76481444-76481466 CTCAAATTATGCCCCCGCCCTGG - Intronic
1141453309 16:84120137-84120159 CTCAATCCCTGCCAACAGCCTGG + Intergenic
1141642541 16:85349608-85349630 CACACACCCTGCCAGCGCCCTGG + Intergenic
1142353040 16:89588471-89588493 CTCAAAACCTGCCAGCCCCTAGG - Intronic
1143462928 17:7115315-7115337 CCCAGACCCTGCCCCAGCCCAGG + Intronic
1144887241 17:18471663-18471685 CTCATTCCCTGCCACCCCTCTGG + Intergenic
1145144975 17:20472632-20472654 CTCATTCCCTGCCACCCCTCTGG - Intergenic
1145277136 17:21438940-21438962 CTCAAACCCAACCACACCCCAGG + Intergenic
1146064164 17:29622262-29622284 CTCCACCCCTGCCCCCGCCACGG + Intronic
1148593652 17:48835375-48835397 CTCAAACCCTTCCCCAGCCTTGG + Intronic
1150285611 17:63952127-63952149 CCTAAACCCTGCCTCTGCCCTGG - Intronic
1152038980 17:77891051-77891073 CTCCTCCCCTGCCACCTCCCAGG + Intergenic
1152070871 17:78133012-78133034 CTCTAACCCCACCACCGGCCAGG - Intronic
1152609370 17:81308123-81308145 CTCAAACCCACCCTCAGCCCAGG + Intergenic
1153856848 18:9157961-9157983 CTCAAATCCTGCCCCCATCCTGG - Intronic
1154274527 18:12947877-12947899 CTCAAGCCCTGCCCACGCCCCGG - Intronic
1156226858 18:35118130-35118152 CTCAAAGCCTGCCCCTGCCAAGG - Intronic
1156485205 18:37461201-37461223 CTCAAGCCCTGCCTCCACCCTGG - Intronic
1157674977 18:49562126-49562148 CTCGCTCCCTGCCACCGCCCGGG + Exonic
1157708184 18:49826978-49827000 CTCTAATCCTGGCACCACCCTGG + Intronic
1159917178 18:74198122-74198144 CTGAACCACTGCCCCCGCCCCGG - Intergenic
1161057741 19:2199166-2199188 CTCAAGACCTGGCACCGTCCAGG - Intronic
1161628287 19:5339289-5339311 CTCAAATCCAGCCACCTCCTGGG - Intronic
1162057175 19:8071684-8071706 CTCCAACCCTGCCTGCACCCTGG - Intronic
1162517027 19:11154731-11154753 CTCAGACCCTGGCACCCACCAGG - Intronic
1162567201 19:11451005-11451027 CTCAACCCCTGCCCACACCCCGG - Intergenic
1164548040 19:29185358-29185380 CTGAAACACTGCCACAGCACTGG + Intergenic
1166037947 19:40182910-40182932 CTCCAGCCCTGCCAAAGCCCAGG + Intergenic
1166349583 19:42189460-42189482 TTCAATCCCTGCTACTGCCCTGG + Intronic
1166452599 19:42914790-42914812 CTCACACCCTGCCTCAGCACAGG - Intronic
1166539187 19:43594343-43594365 CTCAAGCCATGCCCCCACCCAGG - Intronic
1167430854 19:49453591-49453613 CTAAAAGGCTGCCACCGCCAAGG - Intronic
1167502231 19:49854756-49854778 CACTGCCCCTGCCACCGCCCTGG - Intronic
927508579 2:23630183-23630205 CTCCAACCCTGCCAGCACACTGG - Intronic
932403814 2:71500425-71500447 CCCAAACCCTGCTATCGGCCTGG - Intronic
933326547 2:80844943-80844965 GTCACACCCTGCCTCCTCCCTGG - Intergenic
937989444 2:127654166-127654188 CTCACACTCTGCCACCCCCCTGG - Intronic
938548152 2:132353352-132353374 GCCAGACCCTGCCCCCGCCCGGG - Intergenic
942116856 2:172736164-172736186 CTCAACCCCTTCCCCCGCTCGGG - Intronic
945187844 2:207157659-207157681 CACAATCCCTGTCACCTCCCTGG - Intronic
947852731 2:233301257-233301279 CTGAAACCCTCTCACCACCCTGG - Intergenic
948518978 2:238523777-238523799 CCCCATCCCTGCCAGCGCCCAGG + Intergenic
1169453506 20:5732384-5732406 CTGAAGTCCTGCCACCTCCCAGG + Intergenic
1169970238 20:11261838-11261860 CTCAAATCCTCCCAAAGCCCTGG - Intergenic
1170573146 20:17643709-17643731 CCCAAACCCTGTCACTGCCTGGG - Intronic
1171877023 20:30586124-30586146 GCCAGACCCTGCCCCCGCCCGGG - Intergenic
1172780067 20:37431334-37431356 ATCAGCCCCTGCCACAGCCCTGG + Intergenic
1172842339 20:37909447-37909469 TTCATTCCCTGCCACCTCCCTGG - Intronic
1173495538 20:43514917-43514939 CTCAGGCCCTGCCTCCGCCTCGG - Intronic
1175226616 20:57448137-57448159 CCCTACCCCTGCCACCTCCCAGG - Intergenic
1175252049 20:57615723-57615745 TTCAAATCCTGCCTGCGCCCTGG + Intronic
1176055158 20:63141386-63141408 CACATACCCTGCCACTGCCATGG + Intergenic
1177044174 21:16148811-16148833 CTGAACCCCTGCCACAGCCTGGG - Intergenic
1177146648 21:17413747-17413769 CTCAAATCCTGCCATCATCCTGG - Intergenic
1179318889 21:40271003-40271025 CTCAAGCCCTGCCATTGCCAGGG - Intronic
1179988808 21:44935221-44935243 CTCAGAGCCTGCCTCTGCCCTGG - Intronic
1180312296 22:11250536-11250558 GTCAAACCATGCCACTGGCCCGG - Intergenic
1180625251 22:17189945-17189967 GTCAAACCCTGCCACCACCGTGG + Exonic
1181483792 22:23218183-23218205 CTCAGGCCCTGCCAGTGCCCTGG + Intronic
1181618224 22:24069896-24069918 CTCTAACCTCGCCACAGCCCAGG - Intronic
1182451615 22:30425205-30425227 CTGAAACCCTCCCACCAGCCTGG - Exonic
1183126325 22:35784879-35784901 CTCAAACCCTGCCACCGCCCTGG - Intronic
1183360530 22:37380798-37380820 GACAAAGCCTGCCACCCCCCGGG + Intronic
1183866747 22:40710319-40710341 CTCAACCCCTGCCTCTGGCCTGG - Intergenic
1184537052 22:45094445-45094467 CTCCAACCCTGACACTTCCCAGG + Intergenic
1185220653 22:49627650-49627672 GTCAACCCCGGGCACCGCCCAGG + Intronic
1185295156 22:50049549-50049571 CCCAAGCCCTGTCACAGCCCTGG - Intronic
950014076 3:9743963-9743985 CTCAACCCCTGCCATTCCCCAGG + Intronic
950703630 3:14766885-14766907 CTCAAAGCCTCCCACAGCTCTGG - Intronic
954410278 3:50367599-50367621 CCCAAACCCTGCCCCTGCCAGGG - Intronic
955255979 3:57331892-57331914 CTCATACCCTGCCATCTCCCAGG + Intronic
955365583 3:58307137-58307159 CTCAATCCCCGCCACCACACAGG - Intronic
957240721 3:77658085-77658107 CTCATTCACTGCAACCGCCCTGG - Intergenic
960055692 3:113274834-113274856 GTCCATCCCTGCCACCTCCCAGG + Intronic
962394218 3:135000873-135000895 CTCAAACCCTGCCAGGAGCCAGG + Intronic
966182331 3:177197931-177197953 CTCCACCCCGGCCACCGCGCGGG - Intergenic
967042298 3:185704777-185704799 CTCAAACCCAGACACCACACGGG + Intronic
969520220 4:7673902-7673924 CTAATTCCCTGCCACGGCCCAGG + Intronic
970122322 4:12770462-12770484 CTCAAACCCAGCCAGCTCCTTGG + Intergenic
977245426 4:94625043-94625065 CCAAAACACTGCCACTGCCCAGG - Intronic
977957961 4:103052339-103052361 CTCACCTCCTGCCACGGCCCGGG + Intronic
981943889 4:150318090-150318112 CTCAAACTCTGCCACTGACTGGG - Intronic
983646113 4:169993253-169993275 CTGAAACCCTACTACCTCCCTGG + Intronic
984936980 4:184898129-184898151 CTCAATCCCTGCCTCTGTCCAGG - Intergenic
985508679 5:299350-299372 CTCAAACCCCGTCACCTCCCTGG + Intronic
985711086 5:1430365-1430387 CCCAAAACCTGCCTCCGCCCCGG + Intronic
987003179 5:13681861-13681883 CTGTCACCCTGCCACCTCCCTGG + Intergenic
992023475 5:72648465-72648487 CTCAAACCCTGCCTTCTCCATGG + Intergenic
992399694 5:76401345-76401367 TTCAAACCCTGTCACCTTCCTGG + Intergenic
993619720 5:90153576-90153598 CTCAAACCCTGGCTGCGCACTGG - Intergenic
997357652 5:133274096-133274118 ATCAGCCCCAGCCACCGCCCTGG - Intronic
999399549 5:151253706-151253728 CTCAAACCCTCCCAACTCTCAGG - Intronic
1001560962 5:172668744-172668766 CTCCCGCCCTGCCACCTCCCAGG + Intronic
1005848662 6:29802140-29802162 CTCATGCCCTGCCTCCTCCCTGG + Intergenic
1006718663 6:36136177-36136199 TTCACACCCAGCCACGGCCCAGG + Intronic
1013365582 6:109435156-109435178 CTCACACCCTGGCACCGAGCTGG - Intronic
1018649783 6:165983869-165983891 CTCAAACACTGCCAGCTACCTGG + Intronic
1019340027 7:504553-504575 CTCACACCCTGCCATCTCCCAGG + Intronic
1019391161 7:787415-787437 CCCCAACCCTGACACCCCCCAGG - Intergenic
1019428778 7:989043-989065 CTCAGTCCCTGCCAGCCCCCAGG + Exonic
1022594759 7:31702460-31702482 CTCAAGCTCTGCCACTGTCCAGG + Intronic
1024512370 7:50213820-50213842 CTCAGCCCCTCCCACTGCCCTGG - Intergenic
1026932459 7:74231339-74231361 AGCAAACCCTGCCCTCGCCCTGG + Intergenic
1028871136 7:95772700-95772722 CACCAACGCTGCCGCCGCCCAGG + Exonic
1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG + Intergenic
1029688223 7:102163483-102163505 CTCAGACCCTCCCACAGGCCTGG - Intronic
1032420772 7:131777424-131777446 CTCCCAGCCTGCCACCTCCCTGG - Intergenic
1035390500 7:158501266-158501288 CTCAGACCCTCTCCCCGCCCGGG + Intronic
1036756901 8:11476980-11477002 CTCAGGCCCTGCCTCCTCCCTGG - Intergenic
1042240052 8:66654723-66654745 CTCCAACCCTCCTAACGCCCAGG + Intronic
1047567954 8:126066873-126066895 GTCAAACCCTGCCCACACCCCGG + Intergenic
1049343560 8:142126704-142126726 CTCCAGCCCTGCCAGAGCCCAGG - Intergenic
1053004120 9:34593162-34593184 CTCACACAGTGCCAGCGCCCGGG + Intergenic
1056824851 9:89869802-89869824 CTGAAACCCTGCCACCTCCCAGG - Intergenic
1057460143 9:95253787-95253809 CCCCATCCCTGCCCCCGCCCTGG - Intronic
1059320451 9:113464407-113464429 CTCAAACCCTGAGGCAGCCCTGG - Intronic
1061037320 9:128120935-128120957 TTCCAGCCCTGCCACTGCCCTGG - Exonic
1061247487 9:129408182-129408204 CTCAATCCCTCCCTCCACCCAGG + Intergenic
1061316431 9:129799138-129799160 ATCAAATCCTGCCAGCACCCCGG + Intergenic
1062043020 9:134412700-134412722 CCCAACCCCTGCCCCCTCCCCGG - Intronic
1062263426 9:135675117-135675139 TCCAACCCCTGCCACAGCCCCGG - Intergenic
1186411569 X:9348671-9348693 TTCAAACACTCCCACCACCCAGG + Intergenic
1190108981 X:47577760-47577782 CTCATACCATGCCTCTGCCCGGG - Intronic
1193919080 X:87404305-87404327 CGCAACCCCTGCCACCCCCAGGG + Intergenic