ID: 1183127691

View in Genome Browser
Species Human (GRCh38)
Location 22:35800472-35800494
Sequence TTCTACTTGATTGAAGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183127691_1183127692 -2 Left 1183127691 22:35800472-35800494 CCTAAAGCTTCAATCAAGTAGAA 0: 1
1: 0
2: 2
3: 21
4: 187
Right 1183127692 22:35800493-35800515 AAACCTATGCTTTTATCCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183127691 Original CRISPR TTCTACTTGATTGAAGCTTT AGG (reversed) Intronic
904945298 1:34194818-34194840 TTCTAATTCAGTGAAGCTATTGG + Intronic
907322461 1:53613584-53613606 GTTTAATTTATTGAAGCTTTTGG - Intronic
909127907 1:71698176-71698198 TTTTACTTGAATGAAGCCTCAGG - Intronic
914229931 1:145756505-145756527 TTCTAATTGAATGATTCTTTAGG - Intronic
920331742 1:205213060-205213082 TTCTATTTTACTGAACCTTTGGG - Intergenic
920607604 1:207404719-207404741 TTGTACTTTATAGAAGTTTTCGG + Intergenic
922736792 1:227989212-227989234 TTCTCTTGGATGGAAGCTTTGGG - Intergenic
924357199 1:243192655-243192677 TTCTAATTAAGTGAAGCGTTTGG + Intronic
1063264094 10:4426478-4426500 ATCTACTTAATTGAAGTTATGGG + Intergenic
1063674226 10:8125616-8125638 TTCTATTTGATTTGAGATTTTGG + Intergenic
1063729727 10:8682397-8682419 TTCTACTTAGTGGAAGCTCTGGG - Intergenic
1065783515 10:29192205-29192227 TTCTACTGGAAGGCAGCTTTGGG + Intergenic
1066979003 10:42394149-42394171 TTTTACTTGATTAAAACTATGGG - Intergenic
1067244971 10:44532645-44532667 TTCTAGTTTACTTAAGCTTTTGG - Intergenic
1067382545 10:45788213-45788235 TTCTACTTGATTGTATATTTTGG + Intronic
1067890249 10:50128761-50128783 TTCTACTTGATTGTATATTTTGG + Intronic
1068864769 10:61883370-61883392 CTCTAATTGATTCAAGCCTTGGG + Intergenic
1069114079 10:64482773-64482795 TTCTAGTTCATTGAAAATTTTGG + Intergenic
1071585611 10:86817946-86817968 TAGTACTTTATTGAAGATTTTGG - Intronic
1080648447 11:34204114-34204136 TTTTACTATATTGAGGCTTTGGG + Intronic
1081055839 11:38410141-38410163 TTCTGCTTAATTGAACATTTCGG + Intergenic
1081186814 11:40053099-40053121 TTCTAGATGGTTGATGCTTTAGG + Intergenic
1081706038 11:45182320-45182342 GTCCACTTGCTGGAAGCTTTTGG - Exonic
1082604293 11:55204826-55204848 TTCCTCTTGATTGAACATTTTGG - Intergenic
1083132432 11:60637859-60637881 TTCTTCTTGATTCAAGCTTGGGG - Intergenic
1086123009 11:83319767-83319789 TTCTACCTAATTGAATATTTCGG + Intergenic
1086393860 11:86393946-86393968 TTCTCCTTTTATGAAGCTTTGGG + Intronic
1086850883 11:91806697-91806719 TTCTATTTGATGGAATCTTTAGG + Intergenic
1088044707 11:105434292-105434314 TTCAAATTGGTTCAAGCTTTTGG + Intergenic
1090541998 11:127716650-127716672 TTCCACTTGATACAAGTTTTAGG - Intergenic
1092419622 12:8319639-8319661 TTCTACTTGCCTGGAGCTCTGGG + Intergenic
1094457372 12:30651918-30651940 TTCTACTTGATTGAAGTGCTAGG - Intronic
1095153534 12:38824069-38824091 TTCTGTTGGATTTAAGCTTTGGG - Intronic
1095481224 12:42638158-42638180 TTCTACTTGATTGGTGTTTCTGG - Intergenic
1097490096 12:60256653-60256675 GTCTATTTAATTGAAGTTTTAGG - Intergenic
1098781335 12:74690655-74690677 TTCTGCATCATTGAAACTTTAGG + Intergenic
1100865442 12:98852426-98852448 TTCTACTTGATTGCAGAATTTGG - Intronic
1101537708 12:105634442-105634464 TTCTACTCTAATGAAACTTTAGG - Intergenic
1101686923 12:107033688-107033710 TTCTAGTTTATTGAAGCTAAAGG - Intronic
1105843530 13:24275494-24275516 TTCTACCTGACTGAAGCTGCGGG + Intronic
1106861975 13:33919638-33919660 TTCTGCTTGCTTTAAACTTTTGG + Intronic
1108470890 13:50765961-50765983 TTCTACTTGACATTAGCTTTTGG + Intronic
1109489268 13:63074725-63074747 TCATACCTCATTGAAGCTTTTGG - Intergenic
1111063375 13:83054595-83054617 GGCTACTTGATGGTAGCTTTAGG + Intergenic
1112015696 13:95329776-95329798 TTGTATTGGATTGATGCTTTTGG + Intergenic
1112882867 13:104131110-104131132 TTTTACTTCACTGAAGCTTCAGG - Intergenic
1116620718 14:47199848-47199870 TTCTACTTCATTGCAAGTTTTGG + Intronic
1116777503 14:49198169-49198191 TTCTACCTGATTGAAGGCTCAGG + Intergenic
1118564023 14:67119444-67119466 TTCTTAATGATTGAGGCTTTTGG + Intronic
1119451485 14:74715090-74715112 TTCTAGTGGTTTGAAGGTTTTGG + Intronic
1120010392 14:79406699-79406721 TTCTCCTTAATTGCAACTTTAGG - Intronic
1124095048 15:26641574-26641596 CTGTCCTTGATTGAAGCCTTTGG + Intronic
1126308539 15:47289022-47289044 TTCACCTTGGTTGAAGCTTCTGG - Intronic
1126746959 15:51836003-51836025 TTCTATTTTAGTTAAGCTTTAGG - Intronic
1126884080 15:53130978-53131000 TCCTACCTGATTGAAGCTTTGGG - Intergenic
1130685151 15:86030759-86030781 TTCTAGTTGCTTGTAGCCTTGGG + Intergenic
1133683355 16:8142048-8142070 TTTTAGTTGTTTTAAGCTTTTGG - Intergenic
1134320033 16:13154416-13154438 CTCTTCTGGATGGAAGCTTTAGG + Intronic
1134597659 16:15508924-15508946 TTGTATCTGATTCAAGCTTTAGG + Intronic
1135759385 16:25124759-25124781 TGCTTCTTGAATGAAGCATTAGG + Intronic
1136671508 16:31862563-31862585 TTCTACTTGTTTGATGCTGGAGG + Intergenic
1146006775 17:29165609-29165631 TTCTACTGCAGTGAACCTTTGGG + Intronic
1146224812 17:31056349-31056371 TACTTTTTGCTTGAAGCTTTAGG - Intergenic
1151036736 17:70809289-70809311 TTCTCCTTGGTTCAACCTTTTGG + Intergenic
1153255013 18:3161773-3161795 TTCTAATTAACTGAAGTTTTTGG + Intronic
1155673645 18:28402968-28402990 TTTCAGTTGGTTGAAGCTTTAGG + Intergenic
1157660653 18:49439407-49439429 TTTTACGTAATTGCAGCTTTAGG - Intronic
1157952896 18:52060276-52060298 TTCTACTTAATTGAAGTCTGAGG - Intergenic
1158173257 18:54622968-54622990 TTATACTTTACTGGAGCTTTAGG - Intergenic
1159463967 18:68755798-68755820 TTCTACATGATTGATTCTTATGG - Intronic
1162442800 19:10703428-10703450 TTCTAATAGATTGATGCTGTAGG + Intronic
1163354825 19:16803436-16803458 TTCTACCTGATTGAAGTTATAGG - Intronic
1163354844 19:16803599-16803621 TTCCACCTGATTGAAGTTATAGG - Intronic
927175704 2:20405705-20405727 TTCTACTTGTTTGAAACCCTAGG + Intergenic
929524626 2:42689975-42689997 TTCTTATTGATTGAAGCTTAGGG + Intronic
931966319 2:67539346-67539368 TTCTTCCTGATTCAAGCTTGGGG + Intergenic
931987030 2:67751981-67752003 CTCTACTTCAGTGAAGCTTTTGG - Intergenic
932203447 2:69854434-69854456 TTATCCTTGAGTGAGGCTTTTGG + Intronic
933143548 2:78823012-78823034 CTAAACTTGATTGAAGCATTTGG - Intergenic
933711244 2:85327642-85327664 TTCTTCTTGCTTGACGCTTTCGG + Exonic
934178834 2:89601631-89601653 TACTCCTTGATTGCAGCCTTTGG - Intergenic
934289121 2:91675917-91675939 TACTCCTTGATTGCAGCCTTTGG - Intergenic
935477151 2:103536398-103536420 TTCTTCCTGATTGAAGCTTTGGG + Intergenic
937347870 2:121138024-121138046 TTCTACTTGACAAAAGTTTTTGG + Intergenic
940147245 2:150559072-150559094 TTCTACTATATTGAGGATTTGGG - Intergenic
940726149 2:157338977-157338999 TTGTTCTTGATTGAACCCTTTGG + Intergenic
943524525 2:188999717-188999739 TTCTAATTCATTGTTGCTTTAGG - Intronic
945504626 2:210623861-210623883 TTATGCTTGATTGAAGTTTCTGG + Intronic
945859673 2:215106312-215106334 TTCTACTTGTTAGTAGCTCTGGG - Intronic
945869769 2:215214413-215214435 CTCTATTTGATTGAAGATTGAGG - Intergenic
948278175 2:236725926-236725948 TACTACATCTTTGAAGCTTTTGG - Intergenic
1169644713 20:7797129-7797151 TTATACTTGCTTAAAGCTCTAGG + Intergenic
1170393584 20:15902473-15902495 TTATCGTTGGTTGAAGCTTTAGG - Intronic
1172341098 20:34158279-34158301 TTCCATTTAATTGAAACTTTAGG - Intergenic
1175572053 20:60030864-60030886 TTGTGCTTGATTCAAGTTTTTGG + Intronic
1176947672 21:15003562-15003584 TGCTACTTGAGGGAAGCTTTAGG - Intronic
1183127691 22:35800472-35800494 TTCTACTTGATTGAAGCTTTAGG - Intronic
950318117 3:12023542-12023564 TTTTACTTGATTGAAGCAGTGGG + Intronic
951633428 3:24746092-24746114 TACTTCTTGATTGAGGCTTTAGG + Intergenic
951647445 3:24908418-24908440 TTTTCCTTGATGGAAGCTGTAGG - Intergenic
956330348 3:68100179-68100201 TTCTACATGTTTATAGCTTTTGG - Intronic
957001040 3:74885097-74885119 AACTACTTGAATGAATCTTTAGG - Intergenic
957063572 3:75502194-75502216 TTCTACTTGCCTGGAGCTCTGGG + Intergenic
957762644 3:84578250-84578272 TAGTACTTTATTGAAGATTTTGG - Intergenic
959067497 3:101673402-101673424 TTGTACTTATTTGAAGATTTGGG - Intronic
959523293 3:107345369-107345391 GTCTACTTGATTGATGGTGTTGG - Intergenic
960691567 3:120351384-120351406 TTCTGCCTCATTGAAGCTATTGG + Intergenic
961289798 3:125837171-125837193 TTCTACTTGCCTGGAGCTCTGGG - Intergenic
961897308 3:130178832-130178854 TCCTACTTGCCTGAAGCTTTGGG + Intergenic
962014524 3:131426378-131426400 TTATACTTAATGGATGCTTTAGG - Intergenic
963100454 3:141597791-141597813 TTCAATTTTATTAAAGCTTTTGG - Intronic
964050177 3:152382475-152382497 TTCAAATTACTTGAAGCTTTAGG - Intronic
967446138 3:189568690-189568712 TTATAATAGAATGAAGCTTTTGG + Intergenic
969746131 4:9073666-9073688 TTCTACTTGCCTGGAGCTCTGGG - Intergenic
969830431 4:9791781-9791803 TACTCCTTGATTGCAGCCTTTGG + Intronic
971462342 4:26914126-26914148 TTCTCCTTGATTGTCACTTTAGG + Intronic
972039350 4:34572265-34572287 TTTTACTTGACTGAAGGTTAAGG + Intergenic
972262502 4:37424096-37424118 TTCTACCTGATTTATTCTTTTGG - Intronic
976958199 4:90931808-90931830 AGCTACTTGATTAATGCTTTGGG + Intronic
978744467 4:112175874-112175896 TTCTACTTGATTTAACTTTGGGG - Intronic
978980860 4:114943981-114944003 TTATACTTGACTCAAGCTTGTGG - Intronic
979145112 4:117237114-117237136 TTCTACTTAATTAAACATTTTGG - Intergenic
979244616 4:118486945-118486967 TTCTAATTAAGTGAAGCATTTGG - Intergenic
982188075 4:152823329-152823351 TTCTTCTTGATTCAAGCTTGAGG - Intronic
983754790 4:171321142-171321164 TTCTACTTGTTTGATTCTATTGG - Intergenic
984766486 4:183404243-183404265 TGCTATTTCAGTGAAGCTTTGGG + Intergenic
986147988 5:5098242-5098264 TTCTAATTTATAGAAACTTTGGG - Intergenic
986768899 5:10953818-10953840 TTTTAGTTGATTCAAGCTTACGG + Intergenic
987064782 5:14278964-14278986 TTCATCTTTATTTAAGCTTTTGG + Intronic
989256458 5:39370968-39370990 TTCTCCTTGACTGAAACATTTGG - Intronic
989667267 5:43869703-43869725 TTCTTTTTGATTAAATCTTTTGG + Intergenic
990485573 5:56256692-56256714 TTCTACATAATTGATGTTTTTGG + Intergenic
991341341 5:65614166-65614188 TTTTGCTTTATTGGAGCTTTTGG - Exonic
992654055 5:78890763-78890785 TTCTACGTGACTGAAGCTCAGGG - Intronic
993811057 5:92476456-92476478 TTGTACTTGTTGGATGCTTTGGG + Intergenic
995564363 5:113418137-113418159 TTCTATTTGATAGAGGCTTCAGG + Intronic
995822298 5:116250489-116250511 TTCTATTTGATTGAAGATGGAGG + Intronic
998700898 5:144698513-144698535 TTATAATTAATTGTAGCTTTGGG + Intergenic
998967227 5:147553692-147553714 TTCTCCTTGAATGAAGCTTAAGG + Intergenic
1004471832 6:15936408-15936430 TTCTACTTAATTTGTGCTTTGGG + Intergenic
1005463547 6:26090894-26090916 CTTTCCTTGTTTGAAGCTTTGGG + Exonic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1008347602 6:50447617-50447639 TTCTTGTAGATTCAAGCTTTTGG - Intergenic
1010869331 6:81018243-81018265 TTCTAATTGATTTAATCTTTTGG + Intergenic
1011468832 6:87687544-87687566 TTCTCCTTGATTGAATCTTAAGG + Intronic
1011696750 6:89920031-89920053 TTATAATTTATTGAACCTTTTGG + Intergenic
1011817299 6:91207688-91207710 TTCTTCTTGATTTAAGCTAGGGG + Intergenic
1011863879 6:91796065-91796087 TTGTAGTTGAGAGAAGCTTTTGG - Intergenic
1014180750 6:118381596-118381618 GTCGACTTTATTGAAGGTTTGGG + Intergenic
1014208463 6:118682700-118682722 TTCTTCCAGTTTGAAGCTTTAGG - Intronic
1014420509 6:121238684-121238706 TTCTATTAGATTCAAGCTATAGG + Intronic
1014700087 6:124675211-124675233 TTCTACTTGATTATAGCCTATGG + Intronic
1016270656 6:142285748-142285770 TTCTATTTGATTTAAGCAATAGG + Intergenic
1018313816 6:162537331-162537353 TGATACTTGTTGGAAGCTTTAGG - Intronic
1019110216 6:169703110-169703132 TTGTACTTGGTTGAAGTTCTAGG + Exonic
1024030860 7:45458406-45458428 TCATACTTGATTGATGGTTTGGG + Intergenic
1024429000 7:49263698-49263720 TTCCATTTGATTGGAGCTTTTGG - Intergenic
1024778380 7:52816193-52816215 TTCCCCTTGATTGATGATTTTGG - Intergenic
1025546915 7:62186328-62186350 TTTTTTTTGATTGAAGCGTTTGG - Intergenic
1026382245 7:69811446-69811468 TCCTTCTTGACTGAAGATTTTGG - Intronic
1027930730 7:84531240-84531262 TTATACTTTATTCAAGCTTCTGG + Intergenic
1032328600 7:130955971-130955993 TGCAACATGATGGAAGCTTTAGG - Intergenic
1036368638 8:8143583-8143605 TTCTACTTGCCTGGAGCTCTGGG - Intergenic
1036882250 8:12522059-12522081 TTCTACTTGCCTGGAGCTCTGGG + Intergenic
1037042211 8:14250227-14250249 TTCTACTTGATCTATGATTTGGG - Intronic
1038892177 8:31737993-31738015 TTCTACTGGACTAATGCTTTAGG + Intronic
1039725359 8:40209627-40209649 TTGTACTTTATTGTAGCTTAAGG - Intergenic
1042843669 8:73149148-73149170 TTATATTTGATTGCAGATTTAGG - Intergenic
1042843675 8:73149196-73149218 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843681 8:73149244-73149266 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843692 8:73149340-73149362 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843698 8:73149388-73149410 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843715 8:73149532-73149554 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843721 8:73149580-73149602 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843727 8:73149628-73149650 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843733 8:73149676-73149698 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843745 8:73149772-73149794 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843750 8:73149820-73149842 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843756 8:73149868-73149890 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843762 8:73149916-73149938 TTATATTTGATTGTAGATTTAGG - Intergenic
1042843774 8:73150012-73150034 TTATATTTGATTGTAGATTTAGG - Intergenic
1043120542 8:76317415-76317437 TGCTACTTGATTGAATAATTGGG - Intergenic
1043869648 8:85418163-85418185 TTCTACTTCATGGAAGTTTAAGG + Intronic
1044835494 8:96291753-96291775 TTCTACTTTATAGAAGATATAGG - Intronic
1046369796 8:113287550-113287572 TTATATTTGATAGAAGCTTCAGG - Intronic
1055482443 9:76723163-76723185 TTCTTCTTTATAGAAGTTTTGGG - Intronic
1057326818 9:94072551-94072573 TTCTGCTTGGTAGAAGTTTTAGG - Intronic
1058136373 9:101312398-101312420 TTCTATGGGAATGAAGCTTTTGG - Intronic
1061478055 9:130882343-130882365 TTCCACTAGATTAAAGTTTTGGG + Intronic
1062336263 9:136070687-136070709 TTCTGCTTGCTTCAAGTTTTTGG - Intronic
1186569313 X:10697622-10697644 TACGAATTGATTGAAGGTTTTGG + Intronic
1187038801 X:15570959-15570981 TTCTACTTGCCTGAATTTTTCGG - Intronic
1188280820 X:28267020-28267042 ATTTACTTGATTGAACCTTTGGG + Intergenic
1188290242 X:28378683-28378705 TTATCCTTGATGGAAGATTTGGG + Intergenic
1188564857 X:31514950-31514972 TTCTACTTGGTTTAAGCAGTTGG - Intronic
1189224917 X:39404444-39404466 TTCTCCTTCTTTTAAGCTTTCGG + Intergenic
1190721386 X:53151802-53151824 TTCTACAACAATGAAGCTTTGGG - Intergenic
1192052005 X:67732926-67732948 TTCTCCTTGCTTGAAGCCTGTGG - Intergenic
1193453408 X:81699583-81699605 TTCTATATGAATGAAGCTTTTGG + Intergenic
1193561267 X:83019893-83019915 TTCTTCTTTTTTCAAGCTTTGGG - Intergenic
1194139517 X:90192521-90192543 TACAACTTGAATGAATCTTTAGG - Intergenic
1194659260 X:96610921-96610943 TTCTGCTTTATTGAAAATTTAGG - Intergenic
1194862706 X:99022666-99022688 TTCCTATTGATTGAAACTTTTGG + Intergenic
1196763548 X:119222467-119222489 TTCAACTTGCTTGAAACTTAAGG - Intergenic
1197554864 X:127940475-127940497 TTTTGCTTGATTGAAACTTCAGG - Intergenic
1197950691 X:131892970-131892992 TTCTCCTTTATTGAAGCTGAAGG - Intergenic
1198478835 X:137022223-137022245 TTCTACTAGCTTGTAGTTTTGGG + Intergenic
1199121328 X:144057632-144057654 ATCTACTTGATTGATGATTCAGG - Intergenic
1199583176 X:149381300-149381322 ATATACTTGATTGAAGCTGCTGG - Intergenic
1199752650 X:150835760-150835782 TTCTAGTGGACTGAAGCTTGGGG - Intronic
1200485260 Y:3761467-3761489 TACAACTTGAATGAATCTTTAGG - Intergenic