ID: 1183133010

View in Genome Browser
Species Human (GRCh38)
Location 22:35857626-35857648
Sequence AAATAGCCATGGCCATAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183133010 Original CRISPR AAATAGCCATGGCCATAATG GGG Intronic
902461021 1:16576775-16576797 AAATGTCCATGGCCAGAGTGAGG - Intronic
902461802 1:16583052-16583074 AAATGTCCATGGCCAGAGTGAGG - Intronic
902462582 1:16589357-16589379 AAATGTCCATGGCCAGAGTGAGG - Intronic
903158982 1:21471247-21471269 AAATGTCCATGGCCAGAGTGAGG + Intronic
904605444 1:31695527-31695549 AAATGGCCACGGGCATCATGGGG - Intronic
913543245 1:119841893-119841915 AAATGTCCATGGCCAGAGTGAGG - Intergenic
913602897 1:120439162-120439184 AAATGTCCATGGCCAGAGTGAGG + Intergenic
913603645 1:120445515-120445537 AAATGTCCATGGCCAGAGTGAGG + Intergenic
913640509 1:120808229-120808251 AAATGTCCATGGCCAGAGTGAGG + Intronic
913641278 1:120814513-120814535 AAATGTCCATGGCCAGAGTGAGG + Intronic
914084138 1:144437403-144437425 AAATGTCCATGGCCAGAGTGAGG - Intronic
914190160 1:145402674-145402696 AAATGTCCATGGCCAGAGTGAGG - Intronic
914212015 1:145588395-145588417 AAATGTCCATGGCCAGAGTGAGG - Intergenic
914277206 1:146135815-146135837 AAATGTCCATGGCCAGAGTGAGG - Intronic
914277971 1:146142112-146142134 AAATGTCCATGGCCAGAGTGAGG - Intronic
914364072 1:146962779-146962801 AAATGTCCATGGCCAGAGTGAGG + Intronic
914364831 1:146969066-146969088 AAATGTCCATGGCCAGAGTGAGG + Intronic
914365592 1:146975361-146975383 AAATGTCCATGGCCAGAGTGAGG + Intronic
914486849 1:148118079-148118101 AAATGTCCATGGCCAGAGTGAGG - Intronic
914487607 1:148124361-148124383 AAATGTCCATGGCCAGAGTGAGG - Intronic
914538253 1:148586763-148586785 AAATGTCCATGGCCAGAGTGAGG - Intronic
914539016 1:148593060-148593082 AAATGTCCATGGCCAGAGTGAGG - Intronic
914587177 1:149073226-149073248 AAATGTCCATGGCCAGAGTGAGG - Intronic
914587954 1:149079515-149079537 AAATGTCCATGGCCAGAGTGAGG - Intronic
914627661 1:149478564-149478586 AAATGTCCATGGCCAGAGTGAGG + Intergenic
916295502 1:163214643-163214665 AAAGAACTTTGGCCATAATGGGG - Intronic
917495920 1:175540139-175540161 GAATTGCCATGGTAATAATGTGG - Intronic
921563539 1:216687725-216687747 AAAAAGACACGGCCACAATGTGG - Intronic
921771041 1:219040193-219040215 AAATTACCATGGCCATTAGGTGG + Intergenic
922567879 1:226612694-226612716 AAATATCCATGGCATAAATGAGG - Intergenic
923383271 1:233442535-233442557 AAACATCCATGGCTATAAAGAGG + Intergenic
923418994 1:233793947-233793969 AAATAGCCAAGGCAATACTAAGG + Intergenic
1064994674 10:21286079-21286101 AAAGAGCCAAGGTCATAGTGAGG - Intergenic
1065858729 10:29852261-29852283 TCATAGCCATGGCCAAGATGTGG - Intergenic
1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG + Exonic
1069229493 10:65991215-65991237 AAATAGCCAAAGCAATACTGAGG - Intronic
1076328928 10:129650913-129650935 AAAAAGTCCTGGCCACAATGCGG - Intronic
1077807147 11:5601782-5601804 AAACAGCAATGGCCACAATAAGG - Intronic
1080275294 11:30496939-30496961 ATATAGCAAGGGCAATAATGGGG + Intronic
1080970300 11:37266296-37266318 AAATATGCATGCCCATGATGAGG - Intergenic
1082862064 11:57866487-57866509 AAATGGCAATGGCCAGAAAGTGG + Intergenic
1088394636 11:109352898-109352920 AACTAGCCTTGGACATAATGTGG - Intergenic
1090650633 11:128802937-128802959 CTATAGCCATGGCCATAATTTGG + Intronic
1092841791 12:12549478-12549500 AAATAGCTATAGGCAAAATGAGG - Intronic
1095709520 12:45273717-45273739 AAATAGAAATGGCTCTAATGGGG - Intronic
1098809849 12:75072973-75072995 AAATAGACATTTCCATAATAAGG - Intronic
1098887590 12:75975950-75975972 AGTTAGAAATGGCCATAATGAGG - Intergenic
1099099241 12:78416598-78416620 AAATAACCAAGTCCATAATTAGG - Intergenic
1101030886 12:100658601-100658623 AAACAGCCAGGGACATAAAGTGG - Intergenic
1104249676 12:127079738-127079760 AAACAACCATGGTCATACTGAGG - Intergenic
1106659186 13:31780601-31780623 AAATAGCTATTGCCATATTTGGG + Intronic
1109216977 13:59600495-59600517 AAATTGACATTGGCATAATGTGG - Intergenic
1109239159 13:59862444-59862466 AAAAACCCATGGCAATAATCAGG + Intronic
1114577620 14:23728375-23728397 ACAAAGCCATGGCCAGACTGGGG - Intergenic
1118726693 14:68633820-68633842 AAACAGCCCTGGCCAAAAAGAGG - Intronic
1122590732 14:102848783-102848805 AAACAGCAAAGGCCAGAATGAGG - Intronic
1123156285 14:106229806-106229828 AAATGCTTATGGCCATAATGAGG - Intergenic
1126968661 15:54084533-54084555 AAATGGCAATGGCCATAAAGGGG - Intronic
1128174761 15:65545405-65545427 AAATAGGCATGGCAATCAAGAGG + Intronic
1130061034 15:80570064-80570086 AAATACCCATGGCTATAACAAGG - Intronic
1131312693 15:91305162-91305184 AAATAGCAATGGTGATGATGTGG + Intergenic
1134066924 16:11234218-11234240 ATATAGACCTGGCCACAATGGGG + Intergenic
1134270992 16:12733168-12733190 AAATAACCATGCCTACAATGTGG + Intronic
1134997981 16:18754205-18754227 AAATCCCCATGGCCACCATGTGG - Intergenic
1135106900 16:19657704-19657726 AAATAGCCAGGGCCATGATGTGG + Intronic
1139096120 16:63706230-63706252 AAATTGCAATGTCCAAAATGGGG + Intergenic
1141279382 16:82617207-82617229 AAATTGCCCTGGCAACAATGTGG + Intergenic
1143495386 17:7309230-7309252 ATATAGCCAGGGCTATAATTAGG - Intronic
1147448296 17:40488297-40488319 AAAGAGCCGTTGCCTTAATGAGG - Intronic
1149656088 17:58310268-58310290 AAAGAGCCATGTCCTAAATGGGG + Intronic
1151478934 17:74358860-74358882 ACATGGCCAAGGCCAGAATGAGG - Intronic
1152190858 17:78886391-78886413 TAAAAGCCATGGCCACAATGGGG - Intronic
1152998547 18:431563-431585 AAATAGGGATGGCATTAATGTGG + Intronic
1156641760 18:39109452-39109474 AAATTGCCCTGGCTATTATGTGG + Intergenic
1157824450 18:50800312-50800334 AAATGGCCATGTCTATAATTTGG + Intronic
1158545800 18:58395459-58395481 AAATCGCCCTGGCAATAGTGAGG - Intronic
1160323243 18:77915676-77915698 AAATAGAAATGGGCAAAATGAGG + Intergenic
1164926932 19:32138078-32138100 AAATACCCATGGCCAAATTTTGG - Intergenic
1165001000 19:32762248-32762270 AAAAAGCCATTGCCATACTCAGG + Intronic
1165522727 19:36327523-36327545 AAATAGCCATGCTCTTAATTTGG - Intergenic
1165659010 19:37558370-37558392 AAATAGCCATGCTCTTAATTTGG - Intronic
1167152961 19:47720059-47720081 TCAGAGCCATGGCCACAATGAGG - Intronic
1202677454 1_KI270711v1_random:20515-20537 AAATGTCCATGGCCAGAGTGAGG - Intergenic
1202678239 1_KI270711v1_random:26799-26821 AAATGTCCATGGCCAGAGTGAGG - Intergenic
930470784 2:51809881-51809903 AGAAAGCCATGTCTATAATGAGG + Intergenic
931559092 2:63537381-63537403 AAATTGCCCTGGCAACAATGTGG - Intronic
934959714 2:98660461-98660483 AAATAGCCAAGGTAATCATGAGG + Intronic
936795997 2:116204555-116204577 ACATGGCCATGGCCATGCTGGGG + Intergenic
938082167 2:128376066-128376088 AAAAAGGCATGGCCATCATGAGG - Intergenic
938106697 2:128536335-128536357 AAGTAGCAATGGCCAAATTGGGG + Intergenic
939793525 2:146611499-146611521 AAATAGCCAAAGCAATATTGGGG - Intergenic
940540226 2:155005496-155005518 AAATAGCCATGGCTGTCTTGAGG - Intergenic
947173730 2:227338856-227338878 AAATAGCCATGGCAACATTATGG - Intronic
1170637654 20:18122464-18122486 AAATAGACATGGCAAAAGTGTGG - Intergenic
1171095923 20:22332225-22332247 AAATACCTATGGATATAATGTGG + Intergenic
1173031722 20:39367351-39367373 AAATTCCCCTGGCCAAAATGTGG + Intergenic
1173778628 20:45734859-45734881 AAATAGCCAAGGCAATCATGAGG + Intergenic
1175538478 20:59732623-59732645 AAGAAGCCATGGCCAACATGAGG + Intronic
1176016063 20:62933507-62933529 AAACATCCATGGGAATAATGTGG + Intronic
1176913654 21:14599084-14599106 AAATACTCATGGCTATAATTTGG + Intronic
1177040804 21:16107873-16107895 AAATAGCCAGGGTCAAACTGCGG + Intergenic
1179071437 21:38075128-38075150 CAATAGCCATAGCCAAAATATGG + Intronic
1179929345 21:44557072-44557094 AAACAGCAGTGGCCAGAATGAGG + Intronic
1183133010 22:35857626-35857648 AAATAGCCATGGCCATAATGGGG + Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949570593 3:5288911-5288933 AAAAAGCCATGGCCAGAGGGGGG + Intergenic
950101301 3:10358565-10358587 AAATCCCCATGGGCATTATGTGG + Intronic
950343789 3:12273095-12273117 CAATAAACATGGCAATAATGTGG - Intergenic
953952460 3:47201785-47201807 AAACAGCAATGGCCAAAATGGGG + Intergenic
956599637 3:71006580-71006602 ATTTAGACATGGCCATAATATGG + Intronic
957940265 3:86994264-86994286 AAGCAGCCATGGTCATATTGGGG - Intergenic
958036674 3:88177637-88177659 AAATAGATATGGCTATAAAGTGG + Intergenic
958768745 3:98401902-98401924 AAATACTCATTGCCAAAATGAGG + Intergenic
959407928 3:105984010-105984032 AAATAGCCAAAGCAATATTGAGG - Intergenic
963638372 3:147827606-147827628 AAATAGCAAAGGAAATAATGGGG + Intergenic
965756073 3:172028734-172028756 AAATTGCAATGGTCATTATGTGG - Intergenic
974267649 4:59605463-59605485 GAATAGCCAAGGCCATGCTGAGG + Intergenic
974763620 4:66310236-66310258 AAATTGCCATGGCTCTAATATGG + Intergenic
974820131 4:67056684-67056706 AAATAGCCATTACCACTATGTGG + Intergenic
976599416 4:86924489-86924511 AATTAGCCATGGCCCTGGTGTGG - Intronic
976763676 4:88576994-88577016 AAATTGCCATGGCCAAAAATTGG - Intronic
977208403 4:94190170-94190192 GAATAGCCATCTCCTTAATGAGG + Intergenic
978707586 4:111733378-111733400 AAATAGCCATGGTTATCATTAGG - Intergenic
978893706 4:113859467-113859489 AAATAGCCAAGGCAATTTTGAGG - Intergenic
985871476 5:2560881-2560903 TAATGGCCATTGCCATAGTGAGG + Intergenic
988049621 5:26009946-26009968 AAAAAGCCATGACCAGAAGGCGG - Intergenic
991014277 5:61914985-61915007 AAATATCCATGGCATAAATGAGG + Intergenic
991254246 5:64597088-64597110 AAATAGCCAGGAACATAATTTGG - Intronic
991734864 5:69622511-69622533 TAATAAACATGGCAATAATGTGG + Intergenic
991780114 5:70124207-70124229 TAATAAACATGGCAATAATGTGG - Intergenic
991811298 5:70477646-70477668 TAATAAACATGGCAATAATGTGG + Intergenic
991859401 5:70999636-70999658 TAATAAACATGGCAATAATGTGG - Intronic
991872561 5:71124530-71124552 TAATAAACATGGCAATAATGTGG - Intergenic
994017042 5:94979205-94979227 AAATCCCCATGTCCATAAAGAGG - Intronic
994158326 5:96527780-96527802 CAATATCCATGGCCATGAGGTGG + Intronic
994521624 5:100845069-100845091 AAATGGCGATAGCCATAATTTGG + Intronic
994545163 5:101156473-101156495 TAATTGCCATGGCCATCATTTGG + Intergenic
996636614 5:125697313-125697335 AAATAGCCATGGTGACAATATGG + Intergenic
997666651 5:135634835-135634857 AAGTAGCCATAGCCACATTGGGG + Intergenic
1005753325 6:28903687-28903709 AAATAGCCATAATCATTATGTGG + Exonic
1005847933 6:29796233-29796255 AAATAGCCTTGGCTAGAAAGAGG + Intergenic
1010856392 6:80845964-80845986 AAATAGCCATAGCTATAATAAGG + Intergenic
1011172839 6:84525173-84525195 AGATGGCCATGTCTATAATGAGG - Intergenic
1011882579 6:92048453-92048475 AAATAATAATAGCCATAATGTGG + Intergenic
1013968151 6:115981574-115981596 AAAAAGCCTTCCCCATAATGAGG + Intronic
1014074351 6:117219563-117219585 AAAGAGCCTTGGCCAAAGTGTGG + Intergenic
1016706833 6:147118623-147118645 AAAAAGTCTTGGCCAGAATGTGG + Intergenic
1020476948 7:8607491-8607513 TAATAGCCAAGGGCAAAATGTGG - Intronic
1023330741 7:39113892-39113914 AAAAAGACATGGCCATTATTTGG + Intronic
1030275956 7:107722041-107722063 ACATAGCCATAGCCATTATAAGG + Intergenic
1032903599 7:136338632-136338654 AAAGAGTCATGGCCATCATGTGG - Intergenic
1035715228 8:1748839-1748861 AAATTGTCATGGGCATTATGTGG - Intergenic
1037256860 8:16965160-16965182 AAATAGGAATGGGCATAAAGTGG + Intergenic
1041475029 8:58255086-58255108 AAATAGCCATGCCCAAAATGAGG + Intergenic
1041610525 8:59841872-59841894 AAACAGCCATGTCCATAAGCTGG - Intergenic
1042605216 8:70539098-70539120 AAATAGCCATGTACATGAGGAGG - Intergenic
1046499462 8:115056947-115056969 AAAAAGCAGTGGCCAAAATGAGG + Intergenic
1046537701 8:115536591-115536613 AAATAGTAATGGCAAAAATGAGG - Intronic
1050853915 9:10325354-10325376 AAAGAGATATGGCCAGAATGGGG - Intronic
1051038569 9:12778303-12778325 AAAAAGCCATGACTAGAATGAGG - Intronic
1052441936 9:28509120-28509142 AAATAACTAGGGCCATAAGGAGG - Intronic
1052520182 9:29537115-29537137 AAATAACCAAGGCAAAAATGTGG + Intergenic
1054949891 9:70838292-70838314 AAATTTCCAAGGCGATAATGAGG + Intronic
1055705064 9:78990114-78990136 AGAAAGCCATGGCCATTAGGAGG - Intergenic
1056887114 9:90453819-90453841 AAATAGCCATTGCGATCATACGG + Intergenic
1057430052 9:94985687-94985709 TAATAGCAGTTGCCATAATGTGG + Intronic
1059853401 9:118368319-118368341 TTATACCTATGGCCATAATGAGG - Intergenic
1060312962 9:122480243-122480265 AAATAGACATGTTTATAATGAGG + Intergenic
1203771658 EBV:52804-52826 AAAGTGTCATGGCCACAATGGGG + Intergenic
1186527902 X:10266479-10266501 AAATAGCTATACCCAGAATGTGG - Intergenic
1187106469 X:16248029-16248051 CAAGAGCCATGGCCATAACAGGG - Intergenic
1188274078 X:28178609-28178631 AAATGTCCATGGCAAGAATGAGG + Intergenic
1193216401 X:78869398-78869420 AATAAGCCACAGCCATAATGAGG - Intergenic
1193638646 X:83984624-83984646 AAGTGGGCATGGCCACAATGGGG - Intergenic
1195241226 X:102954223-102954245 AAATAGCCAAGGCAATTCTGAGG - Intergenic
1195842146 X:109185801-109185823 GAATTACCATGGCCATTATGTGG - Intergenic
1198887793 X:141358310-141358332 AAATAGCCATGGACATACAATGG + Intergenic
1199070656 X:143471220-143471242 ATATAAGCATGGCCACAATGTGG + Intergenic