ID: 1183133401

View in Genome Browser
Species Human (GRCh38)
Location 22:35862417-35862439
Sequence CTGTAGTGTTTTAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183133401_1183133406 4 Left 1183133401 22:35862417-35862439 CCGTCTTCCCTAAAACACTACAG 0: 1
1: 0
2: 0
3: 34
4: 321
Right 1183133406 22:35862444-35862466 GGTCTTCTGAAAAGGAAGACTGG 0: 1
1: 0
2: 3
3: 53
4: 247
1183133401_1183133405 -4 Left 1183133401 22:35862417-35862439 CCGTCTTCCCTAAAACACTACAG 0: 1
1: 0
2: 0
3: 34
4: 321
Right 1183133405 22:35862436-35862458 ACAGAAAAGGTCTTCTGAAAAGG 0: 1
1: 0
2: 1
3: 29
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183133401 Original CRISPR CTGTAGTGTTTTAGGGAAGA CGG (reversed) Intronic
901265294 1:7905624-7905646 CTGCAGTGTTCCAAGGAAGAGGG + Intergenic
902136583 1:14311478-14311500 CTATAGAGATTTAGAGAAGATGG + Intergenic
902259850 1:15216501-15216523 TTGGAGAGTTGTAGGGAAGATGG + Intronic
906123340 1:43410378-43410400 TTGTAGTTTTTTAGTAAAGATGG - Intronic
907258063 1:53195367-53195389 CTGTAGTGTATAAGGCCAGAGGG - Intergenic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908136904 1:61142717-61142739 CTGAAGTGTTTTCGGGAGGGAGG + Intronic
908333254 1:63093046-63093068 TTGTTGTGTCTTAGGGAATAGGG + Intergenic
909707582 1:78605680-78605702 TTGTAGTTTTTTAGTAAAGACGG - Intergenic
911756665 1:101565549-101565571 CTGTAGTGATTCAAGAAAGAGGG - Intergenic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
911969897 1:104419290-104419312 TTGTTGTGTTTCAGGGAATAAGG + Intergenic
912102407 1:106226828-106226850 CTGAATTGTGTTAGGTAAGAGGG - Intergenic
913071395 1:115302226-115302248 ATGTAGTGTTTTATTTAAGAAGG + Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
916819705 1:168386539-168386561 CTGTAGTGATTTAGGGATCAAGG + Intergenic
917321155 1:173783012-173783034 CTGTAGTGTTTAAGAGAATTTGG - Intronic
917353267 1:174100588-174100610 TTGTTGTGTCTTAGGGAACAGGG + Intergenic
919612811 1:199767108-199767130 CTGTTTTGTTTCAGGGAATAGGG - Intergenic
919652890 1:200167597-200167619 CTGAATGGTTTTAGGAAAGAGGG - Intronic
920120479 1:203652852-203652874 TTGTTGTGTCTTAGGGAATAGGG - Intronic
920204385 1:204281173-204281195 CTGTTGTTTTTTAGTGACGAGGG - Intronic
920434656 1:205940078-205940100 CTGTAGGGTTTAAGGGGAGTAGG + Intronic
920532977 1:206717997-206718019 GTTTTGTTTTTTAGGGAAGAGGG - Intronic
922910280 1:229210026-229210048 ATGTAGTGATTCAGGCAAGAGGG + Intergenic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
924079174 1:240375037-240375059 CTGTTGTGTCTCAGGGAATATGG + Intronic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1063965883 10:11345372-11345394 GGGTAGTGTCGTAGGGAAGAAGG + Intergenic
1065032910 10:21606203-21606225 TTGTTGTGTCTTAGGGAACAAGG - Intronic
1065976753 10:30848472-30848494 CTGTTTTGATTTGGGGAAGAGGG - Intronic
1067316085 10:45164362-45164384 CTGCAGTGTTTTAGGGTGAAGGG + Intergenic
1068703422 10:60045658-60045680 TTGTTTTGTTTTAGGGAAAATGG + Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1071195106 10:83149698-83149720 TTTTTGTGTTTTAGTGAAGACGG - Intergenic
1072703927 10:97666321-97666343 CTGTTGTATGTCAGGGAAGAGGG + Intronic
1072832002 10:98668500-98668522 CTGTAGCCTTTTAGTGAAGTTGG - Intronic
1073894141 10:108134736-108134758 CTGAAGTGTGTGAGAGAAGAGGG + Intergenic
1074161906 10:110842554-110842576 CAGTAGTGTCTTGTGGAAGAGGG - Intergenic
1075193342 10:120331586-120331608 CTGTTGTGTTTCAGGGAATAGGG - Intergenic
1076305095 10:129460762-129460784 CTCTACTGCTTTGGGGAAGATGG + Intergenic
1077572994 11:3355334-3355356 CTTTGGTGTGTTAGGGAAGTGGG + Intronic
1077822868 11:5767344-5767366 CTGTAGTGGTATTGGGAAGTGGG - Intronic
1078012556 11:7584110-7584132 CTGTAGTATTACAGGGAATAAGG - Intronic
1078212678 11:9283439-9283461 CTTTAGTTTTTTTTGGAAGATGG + Exonic
1078921999 11:15839407-15839429 ATGAAGAATTTTAGGGAAGATGG + Intergenic
1079722399 11:23834448-23834470 CTGCTGTGTCTTAGGGAATAGGG + Intergenic
1080618615 11:33967845-33967867 CTGAAGGGTTTTAAGGAAGGTGG - Intergenic
1080970262 11:37265755-37265777 CAGTAGTGTTTTTGGATAGATGG + Intergenic
1081026452 11:38020278-38020300 CTGTAGTCATTTAGGAAAGCAGG - Intergenic
1086006489 11:82044800-82044822 TTGTTGTGTTTTAGGGACTACGG - Intergenic
1086479690 11:87221536-87221558 CTGTTGTGTTTTAGGTTATATGG + Intronic
1087540576 11:99512825-99512847 CTGTTGTGTCTCAGGGAATAAGG - Intronic
1088947670 11:114530828-114530850 CAGTGATGTTTTAGGGAATAAGG + Exonic
1088952179 11:114582941-114582963 CAGTGGTGTTTTAGGGAATAAGG + Exonic
1092214677 12:6672645-6672667 CTGGAGTGTTTTTGGGAGGAGGG - Intronic
1092966146 12:13645238-13645260 ATGTTGTGTCTTAGGGAATAAGG + Intronic
1093626462 12:21354154-21354176 CATTAGTGTTTTAGGGAGGAGGG - Intronic
1094632645 12:32191892-32191914 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1094769384 12:33636695-33636717 GTGTGGTGTCTTAAGGAAGAAGG - Intergenic
1095936864 12:47693216-47693238 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1096199472 12:49671433-49671455 CTGAAGTGTGATAGGGAAGGAGG + Intronic
1096212671 12:49778436-49778458 CTGAGGGATTTTAGGGAAGAAGG - Intergenic
1096436900 12:51599634-51599656 CTGTAGTGTTTTAGGAATATTGG + Intronic
1097123662 12:56755537-56755559 TTGTTGTGTCTTAGGGAATAGGG + Intronic
1097242920 12:57588542-57588564 CTGTTGTGTTTGAAAGAAGAGGG - Intergenic
1099612861 12:84897018-84897040 TTGTATTTTTTTAGGGGAGAGGG - Intronic
1100497731 12:95141611-95141633 CTGTATCATTTTAGGGAGGAGGG - Intronic
1100618734 12:96251372-96251394 TTGTTGTGTTTCAGGGAATAGGG - Intronic
1101006219 12:100403549-100403571 CAATTGTGTTTTAGGGAGGAAGG + Intronic
1101955771 12:109211421-109211443 TTGTATTTTTTTAGTGAAGATGG + Intronic
1105547632 13:21362663-21362685 TTGTTGTGTCTTAGGGAATAAGG - Intergenic
1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG + Intronic
1106989460 13:35399875-35399897 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1109893467 13:68650940-68650962 TTGTTGTGTCTTAGGGAAAAGGG - Intergenic
1110374957 13:74782841-74782863 TTGTAGTGTTTTAGTAGAGACGG + Intergenic
1110829549 13:80014580-80014602 TTGTTGTGTCTTAGGGAAGAGGG - Intergenic
1111640524 13:90963880-90963902 TTGTTGTGTCTTAGGGAACAGGG - Intergenic
1112556228 13:100471156-100471178 CTGTTGTGTCTTGGGGAATAGGG + Intronic
1113878860 13:113611416-113611438 CTGTGCTGTTTGAGGAAAGATGG + Intronic
1114734288 14:25027569-25027591 TTGTTGTGTCTTAGGGAATAGGG - Intronic
1114950069 14:27739152-27739174 TTGTTGTGTTTCAGGGAATAAGG - Intergenic
1115486807 14:33918320-33918342 TTGTTGTGTCTTAGGGAATAGGG - Intergenic
1116056759 14:39873641-39873663 CTGTAGCATTTTAAGTAAGATGG + Intergenic
1116819162 14:49610964-49610986 CTGAACTTTTTTAGGGGAGAGGG + Intronic
1117008778 14:51449205-51449227 CTGGAGTGTTTTTGGCAAGAGGG + Intergenic
1118872363 14:69753921-69753943 TTGTTGTGTTTTGGGGAAGTAGG + Intronic
1119347316 14:73936954-73936976 CTGTAGACTTTTAGGGATGTTGG - Intronic
1121874729 14:97440828-97440850 CTGTATTGTATCAGGGAAGGAGG + Intergenic
1122169098 14:99856689-99856711 CTGTAGTGATTTATAGAAAAGGG + Intronic
1123005904 14:105323737-105323759 CTGCAGTGATCCAGGGAAGATGG + Intronic
1124410815 15:29435082-29435104 CTGGAGAGTGATAGGGAAGAGGG - Intronic
1125001158 15:34771231-34771253 CTGTAGTTATTTTAGGAAGATGG - Intergenic
1125236745 15:37523653-37523675 CTGTTGTGTCTTAGGGTATAGGG + Intergenic
1125947713 15:43723469-43723491 GTGTAGTGTTTTGGGGGAAAAGG + Intergenic
1127044548 15:55011856-55011878 CTGGAGATTTCTAGGGAAGAGGG - Intergenic
1127211209 15:56776789-56776811 CTGGTTTGCTTTAGGGAAGAGGG - Intronic
1128983579 15:72203189-72203211 CTGTAAGGTTTAGGGGAAGAGGG + Intronic
1129958507 15:79661573-79661595 CTGTAATTTCTTAGGGAACATGG - Intergenic
1130255533 15:82324381-82324403 TTGCAGTGTTCTAGGCAAGAAGG + Intergenic
1130918414 15:88324113-88324135 CTGCTGTGTTTTAGCGAAGGCGG + Intergenic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1134137423 16:11687263-11687285 CTGTAGGGTTTTGGGGGAGGTGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1137227518 16:46528881-46528903 CTGTACTATTTTAAGGAAAAGGG - Intergenic
1137327700 16:47458737-47458759 GTGTTGTGTTTTGTGGAAGAGGG - Intronic
1138193810 16:55037286-55037308 CTGCAGTGATTTATGGCAGAAGG - Intergenic
1138390423 16:56666697-56666719 CTGTTGTGTTTTTGGAATGAGGG - Intronic
1139187262 16:64821554-64821576 TTGGAGGGTTTTAAGGAAGAGGG - Intergenic
1139233005 16:65304769-65304791 CTGTAGCATTTTAGGTGAGATGG - Intergenic
1139738856 16:69017529-69017551 CTGTTGTGGTTAAAGGAAGAAGG - Intronic
1140054832 16:71516529-71516551 CTTTAATGTATTAGGGAAGGAGG - Intronic
1140162622 16:72513766-72513788 CTGTTGTATCTTAGGGAATAGGG + Intergenic
1141038787 16:80654110-80654132 CCGTGGTGATTTGGGGAAGAAGG + Intronic
1141998633 16:87650395-87650417 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1145930413 17:28681371-28681393 CTGAAGCGTGTCAGGGAAGAGGG + Exonic
1147158507 17:38557690-38557712 CTGTAGTGTTTTCAGAAGGAAGG - Intronic
1147455974 17:40538396-40538418 CTGAAATGTTTGGGGGAAGAAGG + Intergenic
1147786232 17:42980558-42980580 CGGTGGTGTTTCCGGGAAGATGG + Exonic
1147940503 17:44043825-44043847 CTGAAGTCTTTAAGGAAAGAAGG + Intronic
1148162052 17:45455848-45455870 CTGTGGAGTTTTGGGGCAGAGGG - Intronic
1148254994 17:46122922-46122944 TTGTTGTGTTTCAGGGAATAGGG - Intronic
1150509344 17:65733155-65733177 TTGTTGTGTCTCAGGGAAGAGGG + Intronic
1150662635 17:67097076-67097098 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1150833947 17:68548025-68548047 TTGTTGTGTCTTAGGGAATAGGG + Intronic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1153641942 18:7165103-7165125 CTGTAGGGTTGTGAGGAAGAGGG - Intergenic
1153977079 18:10278758-10278780 TTGTTGTGTCTTAGGGAATAGGG + Intergenic
1154989911 18:21590987-21591009 CTGGAGAGTTTTAGAGAAAAGGG - Intronic
1155631537 18:27899803-27899825 CTGCAGTGTTTTTGACAAGAAGG + Intergenic
1157181180 18:45499675-45499697 CTGCAGTGTGTTGGGGAAGAGGG + Intronic
1158896219 18:61916161-61916183 CTTTAGTTTACTAGGGAAGAAGG - Intergenic
1158955131 18:62530490-62530512 CTGCAGTGTTTTCAGGAATATGG + Intronic
1158978152 18:62731515-62731537 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1159472362 18:68873292-68873314 CTGTAGTGTTTTGGGAAATCAGG + Intronic
1159592732 18:70352640-70352662 ATGTAGTGTTTTAGGTGGGATGG - Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1162745604 19:12796328-12796350 GTGTAGTCTTATGGGGAAGAGGG - Intronic
1165279379 19:34783453-34783475 CTGGAGTGATTTAGGGCAGGGGG + Intergenic
1165352103 19:35281208-35281230 CTGCTGTGTTTTAGGGGAGATGG + Intronic
1165583727 19:36893789-36893811 CTGTAGTGGTCTAGGAAAGAGGG - Intronic
1165608650 19:37131155-37131177 CTGAAGTGTTTTAGGAAAAGTGG + Intronic
1165830614 19:38728590-38728612 CTGGAGACTTCTAGGGAAGAAGG - Intronic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
926715175 2:15918741-15918763 CTATAGTGTTGTTGGGAACATGG - Intergenic
926722270 2:15969848-15969870 CTGTTGTGTTTCAGGGAATAGGG + Intergenic
926739742 2:16101459-16101481 CAGTCCTGTTTTAGTGAAGAAGG - Intergenic
927031055 2:19121074-19121096 CTTCATTGTTTTGGGGAAGAAGG - Intergenic
928586694 2:32766454-32766476 TTGTTGTGTCTTAGGGAAGCGGG + Intronic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
929156902 2:38796439-38796461 CTGTATTTTTTTAGTGGAGATGG - Intergenic
933239647 2:79905774-79905796 CTGAAGTGTGTTAGGATAGATGG + Intronic
933586022 2:84180202-84180224 CTGTAGTGGTTTGGGGGAAAAGG + Intergenic
934910959 2:98253955-98253977 TTGAAGTATTTTAGTGAAGATGG + Intronic
935091943 2:99903839-99903861 CTGTAATGTATTTAGGAAGAAGG - Intronic
936888577 2:117342068-117342090 CTTTGGTGTTTTAGGATAGAAGG - Intergenic
937296601 2:120813282-120813304 CTGCATTGCTTTGGGGAAGAAGG + Intronic
937625869 2:124043225-124043247 CTGGAATGTTTTAGGGAATGTGG - Intronic
937818538 2:126281042-126281064 CTGTTGTGTCTCAGGGAATAGGG - Intergenic
938411894 2:131072021-131072043 CTGTGGAGTTCTGGGGAAGAAGG - Intronic
938678636 2:133665381-133665403 CTGTTGTGTCTCAGGGAAGTGGG + Intergenic
939623581 2:144449442-144449464 TTGTTGTTTTTTAGGGATGAGGG - Intronic
939867994 2:147496053-147496075 ATGTTGTTTTTTAGGGAAAATGG + Intergenic
939933663 2:148261896-148261918 TTGTTGTGTCTTAGGGGAGAGGG + Intronic
940431376 2:153593632-153593654 GTGTAGGGGTTTAGGAAAGATGG + Intergenic
941801863 2:169668637-169668659 TTGTTGTGTCTCAGGGAAGAAGG + Intronic
942066448 2:172276334-172276356 CGTTAGGGTTTTAGTGAAGATGG + Intergenic
943333523 2:186588074-186588096 CTTTGGTGTATTAGGAAAGAAGG + Intergenic
943459353 2:188151970-188151992 CTGTAGAGATTTAGGCCAGATGG - Intergenic
943518241 2:188913243-188913265 AAGTAGTCATTTAGGGAAGAGGG - Intergenic
943905699 2:193499179-193499201 TTGTTGTGTTTCAGGGAATAGGG - Intergenic
944813906 2:203355657-203355679 CTGTATTTTTTTAGTAAAGACGG - Intronic
945499224 2:210548835-210548857 CAATAAAGTTTTAGGGAAGATGG + Intronic
945509637 2:210685055-210685077 CTGAAGTGTTTTAAGTTAGAAGG + Intergenic
1169547710 20:6667644-6667666 CTGGAGTGGTTAAGGTAAGAAGG + Intergenic
1170252257 20:14297190-14297212 TTGTTGTGTCTCAGGGAAGAGGG - Intronic
1173010644 20:39178580-39178602 CTGGTGGGTTTTAGGGAAGGTGG + Intergenic
1178195907 21:30344813-30344835 TTGTTGTGTCTCAGGGAAGAGGG - Intergenic
1179125736 21:38589063-38589085 GTCTAGTGTTTTGGGGAACAAGG - Intronic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1180878959 22:19190280-19190302 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1181273416 22:21673929-21673951 CTGTAGTGATGTAGGGAGGTGGG + Intronic
1182146572 22:28000457-28000479 CTGTGGGGTATTAGGGCAGATGG + Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183757887 22:39787285-39787307 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1183777244 22:39974537-39974559 CTGTTGTGTTTTAGGTTAGCTGG - Intergenic
1183904516 22:41030413-41030435 CTGTGTTGCTTTAGTGAAGATGG + Intergenic
1185009363 22:48304699-48304721 CTGTTGTGTGTCAGGGAAGCAGG - Intergenic
950036193 3:9887564-9887586 CTGTCCTGTTTAAGGGATGACGG - Intergenic
950632424 3:14291620-14291642 CTGTTGTGTTTCAGGAAATAGGG - Intergenic
951276151 3:20688658-20688680 TTGTTGTGTTTCAGGGAATAGGG + Intergenic
951903249 3:27678099-27678121 TTGTTTTGTTTTAGTGAAGAGGG - Intergenic
952499628 3:33948568-33948590 CTGAACTGTTTTGAGGAAGATGG - Intergenic
952855427 3:37766593-37766615 CTTTAGCCTTTAAGGGAAGATGG + Intronic
954258865 3:49424584-49424606 CTGGAGTGTTTTTGGGTAGAAGG + Exonic
955851803 3:63228031-63228053 TTGAAGGGTTTTAAGGAAGAGGG + Intergenic
956533614 3:70250666-70250688 TTGAAGTGTTCTAGGGAAGCTGG - Intergenic
957518657 3:81290068-81290090 TTGTTGTGTTTCAGGGAAAAGGG + Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
959165311 3:102769625-102769647 TTGTTGTGTTTTAGGAAATATGG + Intergenic
959682870 3:109116175-109116197 CTGTAGTGTTTTAAGAAAAGGGG + Intronic
959921296 3:111871289-111871311 CTGTGTTGTGTTAGAGAAGAGGG - Intronic
960457949 3:117896813-117896835 CTGTTGTGTCTTAGGGAATAGGG - Intergenic
960599432 3:119441128-119441150 TTCTTGTGTTTTAGGGAATAGGG - Intronic
961978547 3:131052766-131052788 CTGTAGGGCTTTAGGTCAGAGGG - Intronic
962412523 3:135153796-135153818 CTGTAATGTTTTTGAGAAGAAGG - Intronic
964309945 3:155381875-155381897 GTTTAGTTTTGTAGGGAAGAGGG - Intronic
965224188 3:165966693-165966715 CTGTTATGTCTTAGGGAAAAGGG - Intergenic
965886694 3:173454953-173454975 CTGTTGTGTCTTAGGGAATAGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967563800 3:190950065-190950087 TTTTAGTGTTTTAGGCATGAGGG - Intergenic
969160839 4:5257632-5257654 CTGTATTGTTTAAGTGAAGTGGG - Intronic
970369801 4:15395254-15395276 CTGGGGTGATTTAGGGAAGAGGG + Intronic
971412961 4:26394808-26394830 CTGGAGTGTTGTAGGGGAGAAGG - Intronic
971874976 4:32296886-32296908 TTGTATTTTTTTAGGAAAGATGG - Intergenic
973304414 4:48629293-48629315 CTGTTCTGTTTTAGGATAGAAGG - Intronic
975124907 4:70770933-70770955 TTGTTGTGTCTTAGGGAATAGGG + Intronic
975992514 4:80271951-80271973 CTGTGATGTTTTGGGGAGGAGGG + Intronic
976229411 4:82825685-82825707 CTGTAATGTTTTAGGCAAAGAGG + Intronic
976376605 4:84352742-84352764 TTTTAGTGAATTAGGGAAGAGGG + Intergenic
976934617 4:90614290-90614312 TTGTTGTGTCTTAGGGAATAGGG - Intronic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
977688345 4:99874887-99874909 CTGTTGTGTCTCAGGGAAGGGGG + Intergenic
978676989 4:111330464-111330486 TTGTTGTGTCTTAGGGAATAAGG - Intergenic
979360992 4:119764812-119764834 TTCTAGTGTTTTGTGGAAGATGG + Intergenic
979387917 4:120092018-120092040 CTGATGTGTTTTTGGGAATAAGG + Intergenic
979625989 4:122846078-122846100 TTGTTGTGTCTTAGGGAACAGGG + Intronic
979690156 4:123550941-123550963 CGTTGGAGTTTTAGGGAAGAAGG + Intergenic
979744466 4:124194035-124194057 TTGTTGTGTCTTAGGGAATAGGG + Intergenic
980594750 4:134939270-134939292 TTGTTGTGTCTCAGGGAAGAGGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981502934 4:145472153-145472175 CTGTGATGTTTTGGGGAATAAGG + Intergenic
981526558 4:145712151-145712173 TTGTTGTGTCTTAGGGAAGTGGG - Intronic
982021719 4:151211372-151211394 CAGTATTGTTTTAGGGAATAAGG - Intronic
982220273 4:153118638-153118660 TTGTATTTTTTTAGAGAAGAGGG + Intergenic
982357683 4:154488730-154488752 CTGTATTTTTTTAGTGGAGATGG - Intronic
982458873 4:155643097-155643119 TTGTTGTGTTTCAGGGAATAGGG - Intergenic
982681698 4:158438798-158438820 TTGTTGTGTCTTAGGGAATAGGG - Intronic
983054797 4:163089231-163089253 CTGTAGTGGTATTGGGAAGTGGG - Intergenic
983981078 4:173998127-173998149 TAGTAGTGTTTTAGGGTGGATGG - Intergenic
984670476 4:182479424-182479446 CTGCAGTGTTCTGGGGATGATGG - Intronic
986439469 5:7767047-7767069 CTGTAGTGGTTAAGAGAAGAAGG - Intronic
988709238 5:33756833-33756855 CAGCACTGTTTTAGGGCAGAGGG - Intronic
989076715 5:37571598-37571620 CTGGAGTGTATTAGGGATAAAGG + Intronic
989532385 5:42523645-42523667 TTGTTGTGTTTCAGGGAATAGGG - Intronic
990677040 5:58198730-58198752 CTGTTGTGTATCAGGGAATAGGG + Intergenic
990964660 5:61432189-61432211 ATTTAATGTTTTAGAGAAGAGGG - Intronic
991053465 5:62297051-62297073 CTGCAGAGGTTTTGGGAAGATGG - Intergenic
991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG + Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
992185397 5:74239486-74239508 CTGTAGTGGTTAGGGGAAGTGGG - Intergenic
992195722 5:74337027-74337049 TTGTAGTGTTAAAGTGAAGAAGG + Intergenic
992918341 5:81482993-81483015 CTGTTGTGTCTCAGGGAATAGGG + Intronic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
995505801 5:112859783-112859805 TTGTTGTGTTTCAGGGAATAGGG + Intronic
1000312591 5:160059611-160059633 TTGTTGTGGCTTAGGGAAGAGGG + Intronic
1000372922 5:160554516-160554538 CTTTAGTGATGTAGGGAAGGAGG + Intergenic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1002881732 6:1258373-1258395 TTGTTGTGTTTCAGGGAAGAGGG - Intergenic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1003005784 6:2380332-2380354 CTGCAGTTTAATAGGGAAGATGG - Intergenic
1003749327 6:9039320-9039342 CTGACTTGTTTTAGGAAAGATGG - Intergenic
1003980861 6:11388517-11388539 CTGCAGTGTTTTGGGGCAGAGGG - Intergenic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1008916841 6:56797301-56797323 CTGTTGTGTTTCAGGGAATAAGG - Intronic
1012404470 6:98879343-98879365 CTACATTGTTTTAGGGAACAGGG + Intronic
1012564895 6:100636455-100636477 TTGTTGTGTCTTAGGGAAGAAGG - Intronic
1012638863 6:101582951-101582973 CTGTACTGTTTGAGAGAACAGGG - Intronic
1013030868 6:106331388-106331410 TTGTAGTGTCTCAGGGAATAGGG - Intergenic
1013088814 6:106880438-106880460 TTGTTGTGTCTCAGGGAAGAGGG + Intergenic
1013253641 6:108360817-108360839 CTCTTGAGTTTTAGGGAAGGGGG - Intronic
1013469851 6:110453457-110453479 CTGTACTGTTTAAGGGATGCTGG + Intronic
1016757844 6:147706396-147706418 TTGTAGTTTTTTAGTAAAGATGG + Intronic
1017298274 6:152825547-152825569 CTGTTGTGTCTCAGGGAACAGGG + Intergenic
1017973848 6:159337011-159337033 ATGTTATATTTTAGGGAAGATGG - Intergenic
1018599213 6:165521272-165521294 CTGTTGTGTCTCAGGGAATAAGG - Intronic
1018961364 6:168451481-168451503 CTGTCATGTTTTAGGAGAGAAGG - Intronic
1020090883 7:5339967-5339989 TTGTTGTGCTTTAGGGAATAGGG - Intronic
1021584359 7:22191922-22191944 CTGTAGTGTTATTAAGAAGAAGG + Intronic
1022236991 7:28471515-28471537 GTGTAGTGTTTTAGAGTATATGG - Intronic
1022414891 7:30169409-30169431 CTGGTGTGGTTTCGGGAAGATGG - Intergenic
1023201078 7:37697576-37697598 CTGTGGTGGTTTAGGAAGGAGGG + Intronic
1023778454 7:43633382-43633404 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1024520047 7:50297577-50297599 CTGCAGCATTTTAGGAAAGAGGG + Intergenic
1024589854 7:50871955-50871977 CAGAACTGTTTTAGGGATGAAGG + Intergenic
1025752572 7:64306535-64306557 CTGTAGTAGTTTAGGAAAGCAGG + Intergenic
1026585697 7:71654327-71654349 CTGGAGGGTTTTATGGGAGAGGG + Intronic
1027917643 7:84346540-84346562 CTGTTGTGTCTCAGGGAATAAGG + Intronic
1028587628 7:92467695-92467717 CTGTGGGGTTTTGGGGAAGCTGG + Intergenic
1029662864 7:101974841-101974863 CAGGAGTGTTTTTGGGAAGGAGG + Intronic
1030345259 7:108426266-108426288 ATCTAGAGTTTTAGGGGAGAGGG - Intronic
1030360423 7:108589787-108589809 CTGAAGTGTTCAAGGAAAGATGG - Intergenic
1030827000 7:114170332-114170354 TCGTTGTTTTTTAGGGAAGAGGG - Intronic
1032005531 7:128299337-128299359 CTGGAGTGATTTAGGGCAGGGGG + Exonic
1032156141 7:129469935-129469957 CTGTATTGTGTCAGTGAAGAAGG + Intronic
1032844453 7:135740619-135740641 CTGAATTGTTTTATGGTAGAAGG - Intronic
1033080568 7:138293156-138293178 CTGTTGTGTCTCAGGGAATAGGG + Intergenic
1033140882 7:138825322-138825344 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033795295 7:144838399-144838421 CTGTCGTGTCTTAGGGAATAGGG - Intergenic
1035610449 8:959268-959290 CTCTAATGTTTTGGGGAAGGAGG + Intergenic
1037428674 8:18785805-18785827 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1038578143 8:28722931-28722953 CAGTAGTCTATTAGGGAAAAGGG + Intronic
1038796953 8:30718569-30718591 CTGATGTGTTTTAGGTAGGAAGG - Intronic
1040459795 8:47636340-47636362 TTGTTGTGTTTCAGGGAATAGGG - Intronic
1041730001 8:61053426-61053448 ATGTAGTGTTTCAAGGAGGAGGG + Intergenic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1041926253 8:63240075-63240097 CTGTTGTGTCTCAGGGAATAGGG + Intergenic
1042409829 8:68451546-68451568 TTGTTGTGTTTCAGGGAATAGGG + Intronic
1042895973 8:73668159-73668181 CTGTAGACTTGTAGTGAAGAAGG - Intronic
1044102406 8:88157242-88157264 CTGTAATTTTTTAGAGAATAAGG - Intronic
1044248019 8:89972878-89972900 CTTTAGTGTTTTGGGAAAGCAGG - Intronic
1044303531 8:90611849-90611871 TTGGAGTCTTTTAGGGAACAGGG - Intergenic
1044414438 8:91920192-91920214 TTGTTGTGTTTCAGGGAATAGGG - Intergenic
1045670264 8:104543517-104543539 TTGTTGTGTCTCAGGGAAGAGGG - Intronic
1045785408 8:105915675-105915697 CAATAGTGTTTTAGGGTAGGGGG - Intergenic
1046474908 8:114729547-114729569 CTGGACTTTTTTAGGGAAAAGGG - Intergenic
1047265998 8:123309798-123309820 CTGTAAAGTTTCTGGGAAGATGG - Intergenic
1047828010 8:128599069-128599091 CAATTGTGATTTAGGGAAGAAGG + Intergenic
1048759156 8:137772102-137772124 TTGTGGTGTTTTAAGGAATAAGG + Intergenic
1048937509 8:139369113-139369135 CTGTAGCATTTCAGGGAAGTTGG - Intergenic
1048946533 8:139453606-139453628 CTGGAGGGTTAAAGGGAAGAAGG + Intergenic
1050321422 9:4456740-4456762 CTGTTGTGTTTCAGGGAATTGGG + Intergenic
1050867379 9:10519917-10519939 TTGTAGTGTCTCAGGGAATAGGG - Intronic
1052411844 9:28131334-28131356 CAGTAGGATTTTAAGGAAGAAGG - Intronic
1054820320 9:69515540-69515562 CTGTTTCGTTTTAGGGAGGAAGG - Intronic
1055266998 9:74505353-74505375 CTGAAATATTTTGGGGAAGATGG - Intronic
1055807392 9:80111847-80111869 CTGTTGTGTCTCAGGGAATAGGG + Intergenic
1056941206 9:90958201-90958223 GTGTAGTGTTTTAGTGTGGAAGG - Intergenic
1058018301 9:100061965-100061987 ATGACCTGTTTTAGGGAAGAAGG - Intronic
1060662715 9:125413915-125413937 CTGGAGGGTTTTAAGCAAGATGG + Intergenic
1186944755 X:14553435-14553457 CAATAGTGTTTAAGGGAACATGG - Intronic
1187438197 X:19291786-19291808 AAGTAGTGTTTTATGGAAGTAGG + Intergenic
1187578706 X:20585792-20585814 ATGTAGGGTTTAAGTGAAGAAGG + Intergenic
1187975325 X:24699356-24699378 CCTTTGTGTTTGAGGGAAGATGG + Intronic
1188821893 X:34785923-34785945 CTGTATTTTTTTAGTAAAGATGG + Intergenic
1189825511 X:44912509-44912531 AAGTAGTGTTTTATGGAAAAAGG - Intronic
1189881297 X:45496311-45496333 ATATACTGTTTTAGGGTAGAAGG + Intergenic
1190070185 X:47273117-47273139 CTGGAGTGTTTTTGGGTAGAAGG + Intergenic
1190406591 X:50094029-50094051 CTGAAGTGTTTGGGGGTAGAGGG - Exonic
1192952438 X:76031351-76031373 CTGTATTTTTTTAGTGGAGAGGG - Intergenic
1195719714 X:107855037-107855059 CTGGAGTGTCATAGGGAAGTTGG + Intronic
1197473719 X:126894403-126894425 TTGTTGTGTTTTAGGGGACAGGG - Intergenic
1200371800 X:155734290-155734312 CTGTTGTATTTTAGGGAATAGGG + Intergenic
1200685005 Y:6250257-6250279 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200990535 Y:9341527-9341549 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200993197 Y:9361844-9361866 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1200995851 Y:9382115-9382137 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200998515 Y:9402467-9402489 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201001025 Y:9470997-9471019 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1201003692 Y:9491325-9491347 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201006348 Y:9511606-9511628 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201063040 Y:10065437-10065459 CTATATTGTTTCAGGAAAGAGGG - Intergenic
1201950991 Y:19563719-19563741 CTGAAGTGTTATGTGGAAGATGG + Intergenic