ID: 1183133993

View in Genome Browser
Species Human (GRCh38)
Location 22:35869085-35869107
Sequence TGAAAGAATCACAGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183133993 Original CRISPR TGAAAGAATCACAGTGGGGT GGG (reversed) Intronic
900959319 1:5909216-5909238 GGGAGGAAGCACAGTGGGGTAGG + Intronic
902093655 1:13924679-13924701 TGGATGACTCAAAGTGGGGTAGG - Intergenic
903391359 1:22965577-22965599 TGAAAGAGTCACACTGGGAAGGG - Intergenic
904372159 1:30056132-30056154 TGAATGAATGACAGTGGGAATGG - Intergenic
905789393 1:40782430-40782452 GGAAAGGATCACTATGGGGTAGG + Intergenic
906074771 1:43043949-43043971 GGAAAAAAGCACAGTGGGCTGGG + Intergenic
906648399 1:47492562-47492584 TGAAAGAAAGACAGTGGGGTTGG - Intergenic
907111098 1:51927259-51927281 TCACAGAATCAAAGTGGGATAGG + Intronic
909169158 1:72272262-72272284 TGAAAGAATCAGAGTAGAGATGG - Intronic
912425326 1:109583509-109583531 TAAAACAATCACAGTTGGGCTGG - Intronic
916575006 1:166059351-166059373 TGAAAGAATCTGGGTGGGGAGGG + Intronic
917586398 1:176431465-176431487 TGAATGAAGCACAGTTAGGTAGG + Intergenic
919875199 1:201860869-201860891 TGAAAGAATGAAAGTGAGGCCGG + Intronic
922054371 1:222026393-222026415 TGGAAGAAGCACAGTGGGAGAGG - Intergenic
922820060 1:228478469-228478491 AGAAAGATTCAAAGTGGGGAGGG + Intergenic
923394918 1:233552492-233552514 TGAAAGTTTTACACTGGGGTCGG - Intergenic
924739866 1:246788837-246788859 TGAGAGAAACACTGTGGTGTGGG + Intergenic
924845937 1:247771062-247771084 TGAAAGAAACACAGTGATATGGG - Intergenic
1062876423 10:946527-946549 TGAAAGAATCTCATAGGGTTAGG + Intergenic
1064266960 10:13832949-13832971 GGAAAGAATCACTGTGTTGTGGG + Intronic
1065824336 10:29556251-29556273 TGAAGGACTCAGAATGGGGTGGG + Intronic
1067431872 10:46250576-46250598 ACAAACAATCACAGTGGGGCAGG + Intergenic
1067441543 10:46311601-46311623 ACAAATAATCACAGTGGGGCAGG - Exonic
1067578241 10:47421062-47421084 ATAAACAATCACAGTGGGGCAGG - Intergenic
1068091059 10:52432707-52432729 TGGAAACATCACAGTGGGGATGG - Intergenic
1068577454 10:58700173-58700195 GGAAATAAACACAGTGAGGTGGG + Intronic
1068897783 10:62226798-62226820 AGAAAGAATCAAAGTAGGCTGGG + Intronic
1069802466 10:71090615-71090637 TGAAAGCTTCTCAATGGGGTGGG + Intergenic
1069861628 10:71475295-71475317 TGTGAGCATCACAGTGGGGAGGG + Intronic
1069869724 10:71525875-71525897 TGAATGAATGAGGGTGGGGTTGG - Intronic
1070495348 10:77016239-77016261 TGAAAGCTTCTCAGAGGGGTTGG - Intronic
1073649965 10:105347893-105347915 TGAATGGATTACAGTGGGATTGG + Intergenic
1073729982 10:106276247-106276269 TAAAATAATCACAGTATGGTGGG - Intergenic
1074278619 10:112029018-112029040 TGAATCAATCACTCTGGGGTTGG - Intergenic
1075333279 10:121590603-121590625 TGAAATAGTAGCAGTGGGGTTGG - Intronic
1075911127 10:126126689-126126711 AGACAGAAGCACAGTGGGGGAGG + Intronic
1076053479 10:127352997-127353019 TGAAATGCTCACAGTGGGATCGG - Intronic
1076229335 10:128807321-128807343 AGAAAGATTCACAGTAAGGTAGG - Intergenic
1076806372 10:132861200-132861222 TCAAGGAACCACAGTGGGGCAGG - Intronic
1077203266 11:1325053-1325075 TGGAAGAATAAGAGTGAGGTAGG + Intergenic
1077828329 11:5835074-5835096 TGAGTGAACCACAGTGGGGCTGG - Intronic
1077962594 11:7090194-7090216 TGTAAGAATCACGCTGGGGAGGG - Exonic
1078297907 11:10093674-10093696 TGAAACAATCACAGTTTAGTGGG - Intronic
1078753188 11:14184679-14184701 TGAAAGAATCACAGTAGTTATGG - Intronic
1078894033 11:15582315-15582337 TGAAAGAATGACTGCAGGGTGGG - Intergenic
1078901551 11:15647359-15647381 AGAAAGAAGCTCTGTGGGGTTGG + Intergenic
1079025427 11:16944056-16944078 TGAAAGAATTAAAGTGGGCCGGG + Intronic
1080298413 11:30756365-30756387 TGAAAAAATAACTGTGCGGTTGG + Intergenic
1082949150 11:58791593-58791615 AGAAAGAGTCAAAGTGGGGAGGG + Intergenic
1083396138 11:62393405-62393427 TGAAAGAATAAGGGTGTGGTTGG + Exonic
1083548258 11:63564883-63564905 TGAAAGGATCTCAGGTGGGTTGG + Intergenic
1085700054 11:78737792-78737814 GCAATGAATCAAAGTGGGGTGGG + Intronic
1086046020 11:82533040-82533062 TGAAAGAAAGAATGTGGGGTGGG + Intergenic
1088579343 11:111300053-111300075 TGGGAACATCACAGTGGGGTGGG + Intronic
1089567481 11:119379353-119379375 TGAAAAGAGCACAGAGGGGTGGG + Intronic
1089872082 11:121684300-121684322 TGAAGGAATCCCAGTGATGTTGG - Intergenic
1091366342 11:135023672-135023694 TGACAGAGTCAGAGTGGGGCGGG + Intergenic
1093648714 12:21618753-21618775 TGAAAGAAAGACAGTGTGGTTGG - Intergenic
1094686368 12:32720123-32720145 TGGGAGAATGACAGTAGGGTTGG - Intronic
1094686372 12:32720143-32720165 TGGGAGAATGACAGTGGGGATGG - Intronic
1095964478 12:47857678-47857700 TGTCAGAATGACTGTGGGGTGGG + Exonic
1096837542 12:54360667-54360689 AGAAAGAACCACAGTTGGGGTGG - Intergenic
1096990229 12:55795520-55795542 TGAAAGAATACCATTGGTGTTGG - Intronic
1098241089 12:68467922-68467944 TGGAAGAGCCACAGTGTGGTGGG - Intergenic
1099573331 12:84353331-84353353 GGGAAGATTCCCAGTGGGGTTGG - Intergenic
1100364956 12:93911606-93911628 GGGAAGAATCACAGAGGGTTGGG - Intergenic
1100636084 12:96435938-96435960 TTAAAGAATCACTGTGGGGCTGG - Intergenic
1100904171 12:99278554-99278576 TGTAAGAATCAAAGAGGGGGAGG - Intronic
1101294738 12:103410132-103410154 TGACTGGATGACAGTGGGGTAGG - Intronic
1103067490 12:117912102-117912124 TCAAAGAATGAAAGTGGCGTAGG + Intronic
1103129392 12:118453765-118453787 TGAAGGAATAGCAGTGGGATTGG + Intergenic
1104071878 12:125353034-125353056 TAAAAGAATCTCTGTGGGGTTGG - Intronic
1104652049 12:130542208-130542230 TGAAAGAATGGCAGAGGGGCTGG + Intronic
1104881735 12:132076201-132076223 TGAAAGAATCAGACTGAGGATGG - Intronic
1105409543 13:20160713-20160735 TGAAAGAATCCTAGGGGGCTGGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105642391 13:22279284-22279306 GGATAGAACCCCAGTGGGGTTGG + Intergenic
1107051873 13:36059441-36059463 TGAAATCATCACAGTGGGCCTGG + Intronic
1107536130 13:41334907-41334929 TGCAAAAAGCACAGTGGGGGGGG - Intronic
1107841462 13:44461669-44461691 TGAAATAATTACAGTATGGTGGG + Intronic
1107855704 13:44613660-44613682 TGAAAGAATCACTGTGGGCCAGG + Intergenic
1108148437 13:47504546-47504568 TGAAAGGGTCACAGCAGGGTTGG + Intergenic
1110600597 13:77368170-77368192 TGAAATAATTTCAGTGGGATTGG - Intergenic
1110884226 13:80613042-80613064 TGAAAGAATCACAGCTGGATGGG - Intergenic
1112423492 13:99275257-99275279 TGGAAGACTCACAGTGCTGTTGG + Intronic
1114385150 14:22246666-22246688 TGTAAGAATCACAGTGGAACTGG + Intergenic
1115314079 14:32008234-32008256 GGAAAGAAGGGCAGTGGGGTGGG - Intronic
1115537146 14:34384017-34384039 CATAAGAATCACAGTGGTGTTGG - Intronic
1116121885 14:40731486-40731508 TGAAAGAACCACAGTGCTCTTGG - Intergenic
1117669372 14:58090918-58090940 AGAAAGAAGCACAGTGGGCCAGG + Intronic
1118899514 14:69974653-69974675 TGAAAGCAGGATAGTGGGGTGGG + Intronic
1119084513 14:71727672-71727694 GGAAAGAATCGCAGTGGAGTGGG - Intronic
1119204043 14:72780932-72780954 TGAAAGAATCGCTAAGGGGTGGG + Intronic
1119498034 14:75097724-75097746 ACAAAGAGTAACAGTGGGGTGGG + Intronic
1119574385 14:75705557-75705579 AAAAAGAATCAGAGTGGGTTAGG - Intronic
1119649871 14:76376023-76376045 TGACAGAATCAAGCTGGGGTGGG - Intronic
1121008833 14:90508025-90508047 TGTAAGAAGCACAGTGGCTTGGG - Intergenic
1121088738 14:91166802-91166824 TAAAAAAATCACAGAGGGGCTGG + Intronic
1121618879 14:95332431-95332453 TGAAAGCAGCGCAGTGGGCTTGG + Intergenic
1121836507 14:97097245-97097267 TGAATGAATGACATGGGGGTTGG - Intergenic
1121887632 14:97559193-97559215 TGAAAGAATGACAATGAAGTTGG + Intergenic
1122431745 14:101654448-101654470 TAAAAGCACCACAGTGGGGGTGG - Intergenic
1122565251 14:102649896-102649918 TTAAAGAATCATAGTGGCCTTGG + Intronic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1202933126 14_KI270725v1_random:57958-57980 TGAAATAATCACAGTGCATTTGG - Intergenic
1125267280 15:37897618-37897640 TGAAAGAATCACAGTGATGATGG - Intergenic
1126287350 15:47028177-47028199 AGAAAGAATCAAACTGGGCTGGG + Intergenic
1127293498 15:57590994-57591016 TGGAAGTATCACAGTGCAGTGGG - Intergenic
1127541356 15:59941847-59941869 TGAAACAATCACAGTGGCAAAGG - Intergenic
1128164057 15:65445943-65445965 GAAGGGAATCACAGTGGGGTGGG - Exonic
1129089330 15:73131870-73131892 AGAAAGGATCACAGTGGTTTGGG - Intronic
1131352797 15:91717138-91717160 TGAAATAAGCACGGTAGGGTAGG + Intergenic
1131365114 15:91832446-91832468 TGAAACAATCATGGTAGGGTAGG - Intergenic
1137724348 16:50646825-50646847 TGAAGGGAAGACAGTGGGGTGGG + Intergenic
1138174242 16:54882327-54882349 TGAAAGAACCAGAGTGAGATGGG + Intergenic
1138970758 16:62140415-62140437 TTAAAGAATCACGGTGGGGCAGG + Intergenic
1139616321 16:68095802-68095824 TGGATTAATAACAGTGGGGTTGG + Intronic
1139732698 16:68960388-68960410 TGAATGAATCCCAGAGGGGAAGG - Intronic
1141274413 16:82573574-82573596 TGAAAGAAACAGAGTAGGGCAGG + Intergenic
1143022475 17:3924009-3924031 TGAGAGAAACGCAGTGGGGGAGG - Intronic
1144653559 17:17021553-17021575 GGAAAGAATGCCAGTGTGGTAGG + Intergenic
1147006020 17:37404871-37404893 TAAAAGGATCACTGTGGGCTGGG - Intronic
1147030527 17:37630933-37630955 TTAAAAAATCACAGTGGGCCAGG - Intronic
1147246007 17:39121450-39121472 AAGAAGAATCACAGTGGTGTTGG - Intronic
1148078275 17:44952507-44952529 TGAATGAATGAGACTGGGGTAGG + Intergenic
1149605520 17:57922236-57922258 TAAAACAAACACAGTTGGGTGGG + Intronic
1149945102 17:60916523-60916545 TGAAAGAACAACAATGGGGTGGG + Intronic
1151112139 17:71690895-71690917 TCAAAGAAACACAATGGGGGCGG + Intergenic
1151431066 17:74063601-74063623 TGAAAGAACCACAGGCAGGTGGG + Intergenic
1151480534 17:74367983-74368005 TCAAAGAAACAAAGTGGGCTTGG + Intronic
1152527490 17:80896963-80896985 AGAAAGAATGCCAGTGGGCTGGG + Intronic
1155109784 18:22702812-22702834 GGAAAGAATCTCAGGGGGGAGGG - Intergenic
1155208638 18:23582504-23582526 TCAAAGAATCCCAGTGGGCCAGG + Intronic
1156175327 18:34538253-34538275 TGAAACAGACACTGTGGGGTTGG + Intronic
1156264893 18:35478776-35478798 TGAAAGAAGTACAGTGGAGTAGG + Intronic
1157539051 18:48486289-48486311 TGAATGAATGAAAGTGGGGATGG + Intergenic
1157758440 18:50240257-50240279 TGAATGAATCAGGGTGGGGTAGG - Intronic
1158688234 18:59634306-59634328 TGATAGATTCACAGTGGGGGAGG - Intronic
1159937964 18:74383543-74383565 TCAAAGACTCAAAGCGGGGTTGG + Intergenic
1160210067 18:76870606-76870628 AGAAAGAAGGACAGTGGGATGGG + Intronic
1165283156 19:34815091-34815113 GGAAAGGTTCAAAGTGGGGTAGG - Intergenic
1165715955 19:38046071-38046093 TCAAGGAATCACAGTGGTGGAGG - Intronic
1167018309 19:46856328-46856350 TGAAAGAATCAGAGAGGGTGGGG - Intergenic
1167482104 19:49739342-49739364 TAAATAAATCACAGTGGGCTGGG + Intergenic
1168340523 19:55620813-55620835 TGAAAGAGTCACTGTGGTGGGGG - Exonic
925497204 2:4465491-4465513 TGATAGAATGAGAGTGCGGTAGG + Intergenic
927011198 2:18906391-18906413 TTAAAGAATCACAGTGGCCTGGG - Intergenic
927152897 2:20205856-20205878 TGAAAGCCTCTCAGTGGGGCTGG - Intronic
928284685 2:29979587-29979609 TGAAAGAATCAAAGTGGCCAAGG + Intergenic
929412308 2:41710792-41710814 TGGGAGATTCACAGTGGGGTAGG + Intergenic
930649940 2:53954342-53954364 AGAAAGAAAGACAGTGGGCTAGG + Intronic
931768503 2:65477689-65477711 AGAAAGGATCACAGGAGGGTGGG - Intergenic
932039524 2:68284514-68284536 TGAGAAAACCACAGTTGGGTAGG + Intronic
932411016 2:71547861-71547883 TGTAAGAAGCACATGGGGGTTGG + Intronic
933555506 2:83825708-83825730 TGAATGAAGCACAGTGGGTAAGG + Intergenic
933690900 2:85178867-85178889 AGATCCAATCACAGTGGGGTTGG - Intronic
934560681 2:95311753-95311775 TGACAGCATCACAGATGGGTAGG - Intronic
936970814 2:118174922-118174944 GGAAAGAATCCCAGGGGGATCGG + Intergenic
939262359 2:139827419-139827441 TGAAAACAGAACAGTGGGGTTGG - Intergenic
940079477 2:149784069-149784091 TCTAAGAATCACTGTGGGGCTGG - Intergenic
940105639 2:150096777-150096799 GAAAAGAATCACAGTGGGCAGGG + Intergenic
940481094 2:154232177-154232199 TGAAAGCTTCACAGTGAGGCAGG - Intronic
940638696 2:156327363-156327385 GTAAAGAATGCCAGTGGGGTGGG - Intronic
940810741 2:158240012-158240034 TGAAAGAATCACAAAAGGGAGGG + Intronic
942833255 2:180262277-180262299 AGAAATATTCACAGTGGAGTGGG - Intergenic
943347832 2:186761149-186761171 TGTAAGAAACACTGTGTGGTAGG - Exonic
947042946 2:225944793-225944815 TAAAGGAATAACAGTGGGGATGG + Intergenic
947443652 2:230145471-230145493 TGAAGGAGTCACAGGTGGGTAGG + Intergenic
948083724 2:235228729-235228751 TAAAAGAGTCACAGTGGTGCTGG + Intergenic
1172356165 20:34281511-34281533 TTTAGGAATCCCAGTGGGGTTGG - Intronic
1172787855 20:37480966-37480988 TGAAAGTATCACTCTGGGCTGGG - Intergenic
1173183072 20:40819178-40819200 AGACAGAAGAACAGTGGGGTGGG + Intergenic
1175247938 20:57592623-57592645 TCCAGGAATCACAGTGGGCTGGG + Intergenic
1175809001 20:61847398-61847420 GGAATGAATCATAGAGGGGTGGG - Intronic
1178598479 21:33975908-33975930 TGCATGAGTGACAGTGGGGTGGG + Intergenic
1180927350 22:19565477-19565499 TGAAAGAAGGTCAGTGGGGCTGG - Intergenic
1181507824 22:23373550-23373572 TGAATGAATCTCAGTGTGGGAGG - Intergenic
1183133993 22:35869085-35869107 TGAAAGAATCACAGTGGGGTGGG - Intronic
1183688106 22:39373776-39373798 TGAAAAAATAACAGTGGGCTGGG - Intronic
1183902226 22:41014932-41014954 TCAAAGACTCACAGGGGGGTGGG - Intergenic
949979581 3:9493462-9493484 TCTAAGAATCAGAGAGGGGTTGG - Intergenic
950031738 3:9858330-9858352 TGGAAGCATCACAGGGGGGAGGG + Intergenic
950316067 3:12003499-12003521 GGAAAGAAACACGGTGGGGTTGG + Intergenic
950689756 3:14646473-14646495 TGAAGGAATGACAGTGGTGGGGG - Intergenic
951298086 3:20963836-20963858 GGGAAGAATCAAAGTGGGGAGGG - Intergenic
951459346 3:22932584-22932606 TGATAGAATCACAGTTTCGTAGG - Intergenic
951846927 3:27094721-27094743 TGAAAGAATCACAGATTGGGGGG - Intergenic
952189415 3:31006844-31006866 TGAACCAATCACAGTGGAATGGG - Intergenic
954035537 3:47849116-47849138 TGACAGAAACTCAGTGGGGGTGG - Intronic
954042056 3:47895989-47896011 TGAAAGAAGCAATCTGGGGTGGG + Intronic
954195555 3:48994731-48994753 TGACAGAATCAGTGTGGGGTGGG - Intronic
954479095 3:50781222-50781244 AAAAAGAATCCCACTGGGGTGGG + Intronic
955095934 3:55798293-55798315 AGAAATAATCACAGAGGGGCTGG + Intronic
956374138 3:68596045-68596067 AGAAAGAAACAGAGTGGGGTGGG + Intergenic
959470923 3:106749124-106749146 AGAAAGAATGAGAGAGGGGTAGG + Intergenic
959476191 3:106815004-106815026 AGAAAAAATTACAGTGGGTTGGG - Intergenic
961346288 3:126265542-126265564 TGAAAGACCCAAAGTGGGGAGGG - Intergenic
963266948 3:143249375-143249397 TGATAGCACCACAGTGGGGTTGG - Intergenic
964012982 3:151912998-151913020 TTAAATAATCAGAGTGGGCTGGG - Intergenic
964556987 3:157950648-157950670 AGAAGGCATCACAGAGGGGTTGG + Intergenic
964813703 3:160694122-160694144 TGAAAGTAAGAGAGTGGGGTGGG + Intergenic
965068340 3:163882237-163882259 TGAAACAGTAACAGTGGAGTAGG - Intergenic
966057468 3:175713287-175713309 TGAAAAAATAACTGTTGGGTGGG - Intronic
967852520 3:194093151-194093173 TGAAAGAATGACAATGGTGAGGG - Intergenic
968211205 3:196850385-196850407 TGAGAAAGTCACAGTTGGGTTGG + Intergenic
968849642 4:3070115-3070137 TGAAAGAATCTCACTGGGCGGGG - Intergenic
969449890 4:7266957-7266979 TGGAAGAATCAGTGGGGGGTGGG + Intronic
970761957 4:19500265-19500287 TGAAAGAAGCACTGTTGGGCTGG + Intergenic
973615225 4:52671582-52671604 TGGAAGAATCAGAGAAGGGTGGG - Intergenic
973642324 4:52915779-52915801 TGAAGGAATCAGCATGGGGTAGG - Intronic
974039051 4:56842324-56842346 TGAGAGAAAGACAGTGGGGCAGG + Intergenic
974806298 4:66884583-66884605 TGAAATAATCACACTGAGGGAGG + Intergenic
976353630 4:84088686-84088708 AGAAAGAATAACATTGGGGAAGG + Intergenic
977459718 4:97310081-97310103 AAAAAGAATCCCTGTGGGGTTGG - Intronic
977822397 4:101489286-101489308 TGATAAAATCACAGTAGGTTAGG + Intronic
979559805 4:122089167-122089189 TGAAAGAATCAGAGTGCTGGTGG - Intergenic
979818276 4:125138303-125138325 TTAAAGATTCACAGTGGAGTTGG - Intergenic
982756088 4:159220350-159220372 TGAAATTCCCACAGTGGGGTGGG + Intronic
986817313 5:11426932-11426954 TCAAAGAAACACAGTGGAGGCGG + Intronic
987396763 5:17431796-17431818 TAAAAGAATCACAATAGGCTGGG + Intergenic
988625449 5:32869998-32870020 AGAAAGAATCACGGTGGTGCAGG + Intergenic
989075245 5:37558619-37558641 TTAAAGAATCAACGTGGGCTGGG - Intronic
990226219 5:53657627-53657649 TATAAGAATAAAAGTGGGGTGGG + Intronic
991292411 5:65045593-65045615 AGAAAGTATAAGAGTGGGGTTGG - Intergenic
991403824 5:66282041-66282063 TGAAATAATCAGAGAGTGGTGGG - Intergenic
994650711 5:102523498-102523520 TGGAAGAAACACAGGGGGTTGGG + Intergenic
996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG + Intergenic
998004168 5:138646365-138646387 TGCAAGATTCACAGTGAGGATGG - Intronic
998278019 5:140776949-140776971 AGAAATAATCACACTGGGGCAGG + Intergenic
998906943 5:146915500-146915522 TGAAGGAATAGCAGTGGGGGAGG - Intronic
999748411 5:154609112-154609134 TGAGAGTGGCACAGTGGGGTGGG - Intergenic
1003262003 6:4525946-4525968 TGAAAGAACCACAGTATTGTTGG + Intergenic
1003363186 6:5448080-5448102 ACAAAGAATCGCAGTGTGGTTGG + Intronic
1003417926 6:5929641-5929663 TGGAAAAGTCACAGTTGGGTGGG - Intergenic
1004414366 6:15411924-15411946 TGAGAGAATCACAGTGAGTTAGG - Intronic
1004583352 6:16975768-16975790 TGGCAGAATCCCAGTGGGCTGGG - Intergenic
1005396042 6:25382952-25382974 TCATAAAATCACAGTGGAGTTGG + Intronic
1005593188 6:27349421-27349443 TTAAAGAAACTCAGTGAGGTTGG + Intergenic
1009485816 6:64220380-64220402 AGGAAGAATTACAGTGGGCTGGG - Intronic
1009715221 6:67384287-67384309 TAATAGAATCACAGTGGTCTTGG + Intergenic
1011233656 6:85191540-85191562 AGTAAGAATTATAGTGGGGTGGG + Intergenic
1011399986 6:86950382-86950404 GGAAGGAATGACAGTGTGGTGGG + Intronic
1013901275 6:115159514-115159536 TGAAAGAAACCAAGTGGGCTTGG + Intergenic
1014392572 6:120881355-120881377 TGAGAGAATTCCAGTGTGGTTGG - Intergenic
1016088513 6:139945548-139945570 TGAAAGAATCAGAGTAGAGGTGG - Intergenic
1016628312 6:146198558-146198580 TGAAAAAATCACCATTGGGTAGG + Intronic
1016771917 6:147861459-147861481 AGAAATAATCACAGTGGGTTGGG - Intergenic
1017619058 6:156276130-156276152 TGAAGGAAGAACAGTGAGGTGGG + Intergenic
1018543972 6:164915229-164915251 AGAAAGAATCACAGTCTAGTGGG - Intergenic
1019630334 7:2045719-2045741 TGAAGGAAGGAGAGTGGGGTGGG + Intronic
1020283138 7:6661247-6661269 TGAAATAATCACAGCAGAGTAGG - Intergenic
1021455580 7:20826480-20826502 TGACAGAATCACAGGGGGAATGG + Intergenic
1021667150 7:22995305-22995327 TGAAAGCATGACAGTGAGCTAGG - Intronic
1022117363 7:27273891-27273913 TGAAAGAAGGCCAGTGTGGTTGG + Intergenic
1023151126 7:37202451-37202473 TGATAAAATCACACTGGGATCGG + Intronic
1024828486 7:53420529-53420551 GGAAAGAATGACAGTGATGTGGG - Intergenic
1026142549 7:67718629-67718651 AGAAAGACTCAAAGTGGGGAGGG - Intergenic
1027411006 7:77917747-77917769 TGCAAGAATATCAGTGGAGTGGG - Intronic
1027877394 7:83788045-83788067 TCAAAGAATCACATGGAGGTTGG + Intergenic
1028074602 7:86496439-86496461 AGAAAGAAAGACAGTGGGGAGGG + Intergenic
1028386924 7:90265506-90265528 TGAATTAATCACAGTGTGCTTGG + Intronic
1032089030 7:128901740-128901762 TGTAACAATTGCAGTGGGGTTGG + Intronic
1032406290 7:131658259-131658281 GGAGAGAATCAGAGTTGGGTGGG + Intergenic
1032932694 7:136692295-136692317 TGAAAGAACCACAGAGGAGCTGG + Intergenic
1033935296 7:146576456-146576478 AGCAGGAGTCACAGTGGGGTTGG + Intronic
1034073856 7:148213529-148213551 CAAATGAATCACAGTGGGGCAGG - Intronic
1034137804 7:148787620-148787642 TGGAAGCCCCACAGTGGGGTGGG - Intronic
1034560754 7:151877813-151877835 TGAAAAAAGCAGGGTGGGGTGGG - Intergenic
1034738820 7:153454356-153454378 TGAAAGTAGGACTGTGGGGTGGG - Intergenic
1040359679 8:46653120-46653142 TCAAGGAATCACTGTGGGGGAGG - Intergenic
1041579779 8:59446093-59446115 TGCAAAAATCACGGTGGTGTTGG - Intergenic
1045656066 8:104387702-104387724 TGAAAGAATTAAAGTGTGCTTGG + Intronic
1046508376 8:115165687-115165709 GGAAAGAATTACAGTGAGGCTGG + Intergenic
1046515569 8:115255031-115255053 GGAAAGAAAGAGAGTGGGGTGGG + Intergenic
1046787665 8:118285525-118285547 TGAAGGGATGGCAGTGGGGTGGG - Intronic
1047119917 8:121890827-121890849 TGAAAGAGTCCCAGTGTGGATGG + Intergenic
1047497645 8:125419888-125419910 TAAAACTATCACAGTGGGGCTGG + Intergenic
1048959882 8:139567683-139567705 TGAAGGCATCAGAGTGGGGATGG - Intergenic
1050152724 9:2632948-2632970 TAAAAGAATGACATTGGGGTGGG - Intronic
1051770849 9:20577694-20577716 AGAAATAAGCACTGTGGGGTGGG + Intronic
1052584930 9:30414778-30414800 TGAAAGACTCACAGTGAGTTTGG - Intergenic
1052837366 9:33261787-33261809 TGATAGATTCTCAGGGGGGTGGG + Intronic
1053612236 9:39726230-39726252 TAAAAAAATATCAGTGGGGTAGG + Intergenic
1054086017 9:60744924-60744946 TAAAAAAATATCAGTGGGGTAGG - Intergenic
1054241280 9:62616162-62616184 TAAAAAAATATCAGTGGGGTAGG - Intergenic
1054555409 9:66650686-66650708 TAAAAAAATATCAGTGGGGTAGG - Intergenic
1056824605 9:89868154-89868176 TGAAACAAACAAAGTGGGCTAGG - Intergenic
1060830228 9:126709065-126709087 TGATTGAATCATGGTGGGGTGGG + Intergenic
1061830298 9:133287974-133287996 TTAAAGAATCAAAGTTGGCTGGG - Intergenic
1186144849 X:6614577-6614599 AGAAAGAATCACAGCAGGGAAGG - Intergenic
1187702092 X:21972611-21972633 TGAAACAATCATAGTTGGCTGGG + Intronic
1188924502 X:36023185-36023207 TGCAAGAATCACAGTGTTATTGG - Intergenic
1189276966 X:39793760-39793782 TGAAATACTGAAAGTGGGGTCGG - Intergenic
1190477719 X:50844277-50844299 TTAAAGAATCAAAGTTGGCTGGG - Intergenic
1191857327 X:65637535-65637557 TGACTGGATCACTGTGGGGTGGG - Intronic
1192369778 X:70503841-70503863 TCAAAGGAGCACAGTGGGGTGGG - Exonic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192811604 X:74552249-74552271 TGAAACAAAGAAAGTGGGGTTGG - Intergenic
1192853531 X:74982647-74982669 TGCAAGAACCACAGTGTGATAGG + Intergenic
1193052289 X:77114520-77114542 TGAAAGAATCACAGTGTTACTGG - Intergenic
1193532216 X:82669506-82669528 AGAAAGACTCAAAGTGGGGAGGG + Intergenic
1195066211 X:101240528-101240550 TCAAAGAGTCACAGTCGGCTGGG - Intronic
1195903716 X:109824246-109824268 TGAAAGACTTCCAGTGGAGTGGG - Intergenic
1196051873 X:111314233-111314255 TGAAAGAATGACAGGGAGGAGGG - Intronic
1199018342 X:142846742-142846764 TGCAAGAATCACAGTGTTATTGG - Intergenic
1199510964 X:148622063-148622085 TGAAAGAGTCAAAGTGAAGTGGG + Intronic
1199955123 X:152736007-152736029 TGAAGGAATGACAGTAGGGAGGG - Intronic
1200604211 Y:5244314-5244336 TAAAAGGATCTCAGTGGGGCAGG + Intronic
1200744273 Y:6889822-6889844 TGAAAGAGTCACAGTGATTTGGG + Intergenic
1201481102 Y:14440463-14440485 TGAAACAAACACAGTGGGTATGG - Intergenic
1201853229 Y:18511846-18511868 GGAAACAATCACAGTGGGAAGGG + Intergenic
1201880092 Y:18808538-18808560 GGAAACAATCACAGTGGGAAGGG - Intronic