ID: 1183134189

View in Genome Browser
Species Human (GRCh38)
Location 22:35871068-35871090
Sequence TACTCAGCAGTATCCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183134182_1183134189 27 Left 1183134182 22:35871018-35871040 CCACTTAAAAGGTTTACTCTTGT 0: 1
1: 0
2: 3
3: 13
4: 207
Right 1183134189 22:35871068-35871090 TACTCAGCAGTATCCTGGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 123
1183134183_1183134189 4 Left 1183134183 22:35871041-35871063 CCTTGCTTCTTCATGCCAGCTGG 0: 1
1: 1
2: 3
3: 25
4: 280
Right 1183134189 22:35871068-35871090 TACTCAGCAGTATCCTGGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 123
1183134181_1183134189 28 Left 1183134181 22:35871017-35871039 CCCACTTAAAAGGTTTACTCTTG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1183134189 22:35871068-35871090 TACTCAGCAGTATCCTGGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183134189 Original CRISPR TACTCAGCAGTATCCTGGGT TGG Intronic
904016858 1:27428405-27428427 CACAGAGCAGTATCTTGGGTCGG - Intronic
905125508 1:35713547-35713569 TACTCAACTGTACCCTGGGCAGG - Intergenic
906611612 1:47207968-47207990 TACTCATCAGACTCCAGGGTGGG - Intergenic
908399378 1:63756071-63756093 GACTCAGGAGTTTCCTGGGAGGG - Intergenic
915304070 1:154968018-154968040 TACTCGGCTGTGTCCTGGGGAGG + Exonic
919355347 1:196515844-196515866 TACTCACCACTTCCCTGGGTTGG - Intronic
919652033 1:200159526-200159548 TACTCAGCAGTTGACTGGGCAGG - Intronic
924843950 1:247746493-247746515 TACTCAGCTGTATCCCAGGATGG - Intergenic
1079504865 11:21142273-21142295 TCCACAGCATTATCCTGGGATGG + Intronic
1080663098 11:34313334-34313356 ACCTCAGCTGTCTCCTGGGTAGG + Intronic
1080666674 11:34342442-34342464 TCCTCAGGAGTGGCCTGGGTGGG - Intronic
1080861786 11:36156366-36156388 TGCCCAGCAGGACCCTGGGTAGG + Intronic
1081477789 11:43452148-43452170 TACTCAGGATTTTCCTGGTTGGG - Intronic
1092947783 12:13472731-13472753 CCCTCAGTAGTATCTTGGGTTGG - Intergenic
1095777637 12:46026797-46026819 TACAGAGCAGTTTCCAGGGTAGG + Intergenic
1097289639 12:57903790-57903812 TGCTCAGCAGTCTCTTGGGTTGG - Intergenic
1098025152 12:66193751-66193773 TACTGACCTGTATCCAGGGTCGG + Intronic
1099837883 12:87930492-87930514 GCTCCAGCAGTATCCTGGGTAGG + Intergenic
1104947825 12:132424722-132424744 TCCTGAGCAGTGTCCTGGATCGG - Intergenic
1107938323 13:45363403-45363425 GATACAGCAGTATCCTGGGAAGG - Intergenic
1112534250 13:100234984-100235006 GATTCAGCAGTGTCCTGTGTTGG + Intronic
1113014095 13:105807689-105807711 TACTCAGCAGTTGCCTCTGTTGG + Intergenic
1114278309 14:21168168-21168190 TACTCACCACTTCCCTGGGTTGG - Intergenic
1115840654 14:37466383-37466405 TGCTCAGCAATATACTGTGTAGG - Intronic
1118017305 14:61673122-61673144 CACTCGGCAGGCTCCTGGGTGGG - Intergenic
1120828392 14:88975622-88975644 TACTCTGCTGTTTCCAGGGTTGG + Intergenic
1122033124 14:98928015-98928037 TACTCGGCAGCAACGTGGGTAGG + Intergenic
1123061659 14:105597306-105597328 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1123086397 14:105719036-105719058 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1125474766 15:40039427-40039449 TATTCAGCTGTATGCTGGGCAGG + Intergenic
1126508848 15:49442371-49442393 TACTCAGCAGTGTGCAGGGGTGG - Intronic
1127655477 15:61051409-61051431 CACTCAGCAGCAGCCTGGGCAGG + Intronic
1129178861 15:73859052-73859074 TACCCAAAAGTATCCTGGGAGGG + Intergenic
1131438272 15:92439928-92439950 TGCCCAGCAGTATCCGGGGGAGG + Intronic
1132996178 16:2824562-2824584 TCCTCAGCATTCTCCTGTGTGGG - Intronic
1133758441 16:8779666-8779688 TACTCAGCAATATTTTGTGTGGG + Intronic
1137367121 16:47870311-47870333 TACTCAGCAGTGGAGTGGGTTGG - Intergenic
1137645849 16:50073324-50073346 AACTCAGCAGAATTCTGGGTGGG + Intronic
1139876130 16:70147599-70147621 TAATCAGCAGCTTCCTGGGGAGG - Intronic
1139939116 16:70591953-70591975 TTCTCACCACTGTCCTGGGTGGG + Intronic
1140193735 16:72839544-72839566 TTCTCAGTAGCATACTGGGTTGG - Intronic
1140359660 16:74333499-74333521 TAATCAGCAGCTTCCTGGGGAGG + Intergenic
1144608447 17:16688332-16688354 AGCTCAGCAGTGTCCTGGGTAGG - Intergenic
1145128211 17:20319265-20319287 AGCTCAGCAGTGTCCTGGGTAGG - Intergenic
1145196395 17:20897942-20897964 AGCTCAGCAGTGTCCTGGGTAGG + Intergenic
1146730208 17:35186594-35186616 TACTGTGCAGAGTCCTGGGTTGG + Exonic
1146969273 17:37059294-37059316 CACTCAGCAGCATCCTGGCCAGG - Intergenic
1147973032 17:44230057-44230079 TGCTCAGCTCTATCCTGGGAAGG - Intergenic
1150439484 17:65179614-65179636 AGCTGAGCAGTATCCTGGCTTGG - Intronic
1151101715 17:71563358-71563380 TACTCAGCAGTGACTTGAGTGGG + Intergenic
1151333956 17:73429212-73429234 TACACAGCAGTATTCTATGTGGG + Intronic
1152444896 17:80336363-80336385 GACTCACCAGTTTCCTGGGCAGG - Exonic
1152462539 17:80449156-80449178 TACCCAGCAGTCTGCTGGGCTGG - Intergenic
1153172986 18:2337579-2337601 TACTCAGCTGTGTCCTTGGTGGG - Intergenic
1157142147 18:45120397-45120419 TTCTCAAAAGTATCCTGGGAAGG + Intergenic
1157727348 18:49974952-49974974 TACTCAGCAGCAGCCTGGCATGG - Intronic
1160156317 18:76436520-76436542 GACTCAGCGGTGTCCTGGCTTGG - Intronic
1165773648 19:38392250-38392272 GTCTCTGCAGTATCCTGGGAAGG - Exonic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1168707479 19:58478166-58478188 TGCTCACCTGAATCCTGGGTGGG - Exonic
927973034 2:27317585-27317607 TTCTCTGCAGTCTCCTGGGCTGG + Intronic
932703096 2:74004022-74004044 TACTCAGCAGTATCCTCTGCTGG + Intronic
935084668 2:99833235-99833257 AACTCAGGAGCATCCTGGATGGG - Intronic
935191671 2:100782938-100782960 TTCTCAAAATTATCCTGGGTGGG + Intergenic
936449850 2:112625892-112625914 ATCTCAGCAGGAACCTGGGTTGG + Intergenic
936907835 2:117557453-117557475 AAATCAGGAGTACCCTGGGTTGG + Intergenic
938132239 2:128726411-128726433 GACTCAGAAGGAGCCTGGGTGGG + Intergenic
939482214 2:142763059-142763081 TTCTCAGTAGTAGCCTGGGCTGG - Intergenic
944736288 2:202569631-202569653 TACCCAACAATTTCCTGGGTTGG + Intergenic
945885555 2:215371955-215371977 TACTCAGAAGTGTCCTGGAATGG + Exonic
946733017 2:222727239-222727261 TACCCAGGAATATCCTGGATAGG + Intergenic
947531086 2:230908984-230909006 TACTCACCTGCATCCTGGCTGGG - Exonic
1171148765 20:22808752-22808774 TACTCAGCAGTATCCCTGGCAGG + Intergenic
1173178011 20:40779359-40779381 CACTCAGCAGCAGCCTGGGCAGG + Intergenic
1174319963 20:49733882-49733904 TACTCAGCTGTAACCTAGGCAGG - Intergenic
1175871663 20:62212149-62212171 TAAACAGCAGTGGCCTGGGTGGG + Intergenic
1179530216 21:42013122-42013144 TTCTCAGCTGTATCTAGGGTTGG + Intergenic
1180225324 21:46388668-46388690 CCCTCAGCAGCATCCAGGGTGGG + Intronic
1181381861 22:22511285-22511307 TACAATTCAGTATCCTGGGTGGG - Intergenic
1183041111 22:35178646-35178668 GAGTCAGCAGTGCCCTGGGTGGG - Intergenic
1183134189 22:35871068-35871090 TACTCAGCAGTATCCTGGGTTGG + Intronic
953093765 3:39754796-39754818 TACTCAGCAGGCATCTGGGTGGG + Intergenic
953882319 3:46696979-46697001 CACTGAGCAGTGTCCTGGGTTGG + Intergenic
955650003 3:61183911-61183933 TTCTCAAATGTATCCTGGGTTGG + Intronic
956265380 3:67390722-67390744 TTCTCAACAGTTTCATGGGTTGG - Intronic
958813643 3:98892195-98892217 TCCTCACCAGTATACTGGTTAGG - Intronic
966817909 3:183904457-183904479 TCGGCAGCAGTGTCCTGGGTGGG - Intergenic
971097829 4:23428120-23428142 TAGCCAGGAGTATGCTGGGTGGG - Intergenic
972952967 4:44351766-44351788 TACTCAGCAGTGTTCTAGGCAGG - Intronic
973822609 4:54676238-54676260 AACTCAGCAGGTTCTTGGGTGGG - Intronic
974762104 4:66290421-66290443 TCCTCAGCAGTTTCCTGAGGAGG - Intergenic
978203402 4:106049718-106049740 TACTGAGCAACATCCTTGGTGGG + Intronic
983905416 4:173176442-173176464 CTCTCAGAAGTGTCCTGGGTTGG + Intronic
987112006 5:14697133-14697155 GACTCAGCAGTATTCTGGGAGGG + Exonic
996150584 5:120029833-120029855 TTCCCACCAGTTTCCTGGGTTGG + Intergenic
999589428 5:153128542-153128564 TACTCAGAAGGGTCCTGGGGAGG + Intergenic
999872069 5:155762874-155762896 GAATCAGGAGTACCCTGGGTAGG + Intergenic
1000731340 5:164837579-164837601 TACACAGCAGTATCATGCATGGG - Intergenic
1002269796 5:178063386-178063408 AAGTCAACAGTATCCTGTGTTGG + Intergenic
1002526986 5:179820538-179820560 GACTCAGCAATATCCTCAGTTGG - Intronic
1007917849 6:45577535-45577557 TTCTCAAAAGTGTCCTGGGTTGG + Intronic
1009194540 6:60668162-60668184 TACACAGCACTATCCTGTCTTGG + Intergenic
1009596482 6:65744339-65744361 CACTCACCACTTTCCTGGGTTGG - Intergenic
1011018169 6:82781881-82781903 TACTCAGCATTACCCTAGCTGGG - Intergenic
1012755215 6:103222170-103222192 TACCCAGCAGTGTCATTGGTGGG + Intergenic
1017004999 6:150023263-150023285 AATCCAGCAGTATCCGGGGTGGG - Intronic
1017634575 6:156431312-156431334 TACTCAGAAGTATCCAAGCTTGG - Intergenic
1018037189 6:159891763-159891785 TACTCCTAAGTATCCTGGCTGGG - Intergenic
1018066601 6:160128976-160128998 TACTCCACAGTATTCTGGTTAGG + Intronic
1020213143 7:6170280-6170302 AACTCAGCAGTTTTCTGGGACGG + Intronic
1020463629 7:8451727-8451749 TATTCAGAAGTATCCTGGTTTGG + Intronic
1022864547 7:34404363-34404385 CAGTCAGCAGCATCCTGGGCTGG - Intergenic
1028733515 7:94180133-94180155 TACTCAGAAGAACACTGGGTTGG + Intergenic
1029336205 7:99901888-99901910 TACTGGGCAGTATCCTGGAGCGG - Intronic
1030399357 7:109028857-109028879 TACAGAACTGTATCCTGGGTGGG - Intergenic
1031128252 7:117800320-117800342 TGCTCAGCAGTTTCCTGAGTTGG + Intronic
1032877291 7:136051207-136051229 TACTTAGGAGTATCCTGGTTTGG + Intergenic
1033756270 7:144400105-144400127 CGCTCAGCGGTAGCCTGGGTAGG - Exonic
1034139068 7:148799798-148799820 TCCTCAGCAGTATCTTCGGGAGG + Intronic
1035858715 8:3005206-3005228 GACTGTGCAGTACCCTGGGTGGG + Intronic
1036385664 8:8278320-8278342 TTCTCAAGAGTATCCTGGTTTGG + Intergenic
1036647732 8:10622730-10622752 TAATCAGCAGTATCCTCCGGGGG + Exonic
1037177214 8:15961733-15961755 TGCTCAGAAGTACCCTGGTTGGG + Intergenic
1040050934 8:43013860-43013882 TGCTCATCAGCATCCTGGTTGGG + Intronic
1040549144 8:48425035-48425057 TCATCAGCAGTAGCCTGTGTAGG + Intergenic
1042932041 8:74023264-74023286 TGCCCTGCAGTATCTTGGGTGGG + Intronic
1043701422 8:83292472-83292494 TCCTCAGCAGTATCCTGTGCTGG + Intergenic
1044125681 8:88456423-88456445 TACTCACCACTTCCCTGGGTTGG - Intergenic
1046383088 8:113475262-113475284 TGGTCAGAAGTATCTTGGGTTGG + Intergenic
1046473471 8:114709986-114710008 TACTCAGAATTTCCCTGGGTAGG - Intergenic
1049624799 8:143615171-143615193 ACCTCAGCAGCCTCCTGGGTGGG - Intronic
1050863657 9:10469638-10469660 TACTCAGCAGTAGAATGGCTTGG - Intronic
1053375948 9:37606421-37606443 CTCTCAGAAGTATTCTGGGTTGG + Intronic
1059458523 9:114414879-114414901 CACTCAGCAGCTTCCTGGGGTGG + Intronic
1059701154 9:116776306-116776328 TACTCAGCACTATGCTTGGTGGG - Intronic
1190109513 X:47581080-47581102 TATCCAGCACTATTCTGGGTGGG - Intronic
1195426464 X:104738201-104738223 CACTCAAAAGTATCCTGGTTTGG - Intronic
1197121996 X:122905099-122905121 CACTCACCACTTTCCTGGGTGGG - Intergenic
1197424771 X:126282457-126282479 AACTCAGGAGAATTCTGGGTGGG + Intergenic