ID: 1183135412

View in Genome Browser
Species Human (GRCh38)
Location 22:35882363-35882385
Sequence TTGCAACCACACCACTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183135412_1183135415 -4 Left 1183135412 22:35882363-35882385 CCCTTTCAGTGGTGTGGTTGCAA No data
Right 1183135415 22:35882382-35882404 GCAATAAAAACCTGGCTGCGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
1183135412_1183135416 -3 Left 1183135412 22:35882363-35882385 CCCTTTCAGTGGTGTGGTTGCAA No data
Right 1183135416 22:35882383-35882405 CAATAAAAACCTGGCTGCGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258
1183135412_1183135418 6 Left 1183135412 22:35882363-35882385 CCCTTTCAGTGGTGTGGTTGCAA No data
Right 1183135418 22:35882392-35882414 CCTGGCTGCGTGGGTTTAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183135412 Original CRISPR TTGCAACCACACCACTGAAA GGG (reversed) Intronic
No off target data available for this crispr