ID: 1183135415

View in Genome Browser
Species Human (GRCh38)
Location 22:35882382-35882404
Sequence GCAATAAAAACCTGGCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183135413_1183135415 -5 Left 1183135413 22:35882364-35882386 CCTTTCAGTGGTGTGGTTGCAAT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1183135415 22:35882382-35882404 GCAATAAAAACCTGGCTGCGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
1183135412_1183135415 -4 Left 1183135412 22:35882363-35882385 CCCTTTCAGTGGTGTGGTTGCAA No data
Right 1183135415 22:35882382-35882404 GCAATAAAAACCTGGCTGCGTGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183135415 Original CRISPR GCAATAAAAACCTGGCTGCG TGG Intronic
903787047 1:25868249-25868271 GGAATAGAAACCTTGCTGGGTGG - Intronic
905548029 1:38815690-38815712 GCAATCAAAACCTGGGTGTGGGG - Intergenic
907573332 1:55504175-55504197 TCAATGAATACCTGGCTGAGTGG + Intergenic
908140406 1:61178725-61178747 GCAATGAAAGCCTGGCTTCGGGG - Intronic
1062769014 10:85237-85259 CCAATAACATCCTGGCTGCCTGG - Intergenic
1063454812 10:6175539-6175561 GCAATAGGAACCTGGCTGGCTGG + Intronic
1071749871 10:88462689-88462711 GGAATAATAACCTGCCTGTGGGG + Intronic
1073339160 10:102731977-102731999 TCCATAAAAACCTGGCTAGGTGG + Intronic
1077079242 11:716862-716884 ACAAGAAAAACCAGGCTGCTGGG - Intronic
1077263152 11:1634011-1634033 GCAGCACAGACCTGGCTGCGTGG + Intergenic
1078695999 11:13632429-13632451 GGAATAAAAGCCTGACTGAGTGG + Intergenic
1080776159 11:35388690-35388712 TCAATAAAAACATGTCTGAGTGG - Intronic
1083110540 11:60401870-60401892 GCAATAAAAACCTGGGATTGAGG + Intronic
1083852159 11:65374640-65374662 GGAATTAAAAACTGGCTGAGAGG - Intergenic
1092394486 12:8113702-8113724 GCAATAAGAACCTGGGTAGGGGG - Intergenic
1092459275 12:8672150-8672172 ACAATAAAATCCAGGCTGTGTGG - Intergenic
1105237460 13:18571663-18571685 ACAATAGAAACCTGGATGAGAGG + Intergenic
1112102890 13:96209670-96209692 GAAATAAAAGCCTGGATGGGTGG - Intronic
1112786799 13:102960377-102960399 GGAGTAAAAAACTGGCTGGGAGG + Intergenic
1112822308 13:103351350-103351372 GTAATAACAAAGTGGCTGCGAGG - Intergenic
1122773587 14:104107638-104107660 TCAATAAAAAGCAGGCTACGTGG + Intronic
1125610390 15:40965507-40965529 GCAATAATAACCAGGCTGGGTGG - Intergenic
1130790540 15:87151116-87151138 GCACTGAAAACCTGGGTGCTGGG + Intergenic
1130987146 15:88852022-88852044 GCCATACCAACCTGGCAGCGGGG - Exonic
1132136575 15:99346796-99346818 TAAATAAAAACCTGTATGCGGGG + Intronic
1132458113 16:35479-35501 GCAAGAACATCCTGGCTGCCTGG - Intergenic
1134229107 16:12415541-12415563 TCAATACCAACCTGCCTGCGAGG - Intronic
1136244948 16:28969613-28969635 GGAAGCAAAACCTGGATGCGTGG - Intergenic
1138578676 16:57925433-57925455 GCAAGAGAAACTTGGCTGTGGGG + Intronic
1138975407 16:62201023-62201045 GAAAGAAAAACCTGGATGAGAGG + Intergenic
1140078736 16:71724417-71724439 GGAATTAAAACATGGCTGGGAGG - Exonic
1140854049 16:78961954-78961976 GCAACAAAGACTTGGCTGCTGGG - Intronic
1141022671 16:80512202-80512224 GCATTAAAAAAATGGCTGCATGG - Intergenic
1141519317 16:84567149-84567171 GCAGAAAAAACCTGACTGGGAGG + Intronic
1145091845 17:19992607-19992629 GGAATAAAAGGCTGGATGCGGGG - Intergenic
1145816799 17:27800814-27800836 CCAAATAAAACCTGGCTCCGTGG - Intronic
1147299797 17:39517147-39517169 GTAATAAAAACCTGTATGGGGGG + Intronic
1149212517 17:54320116-54320138 TCAATAAAATACTGGCTGCAGGG + Intergenic
1151858884 17:76743905-76743927 GTAATAGAAACCAGGCTGGGAGG - Intronic
1152962075 18:86051-86073 GCAAGAACATCCTGGCTGCCTGG - Intergenic
1160986718 19:1842567-1842589 GCTTTGAAAACCTGGCTGCTGGG - Intronic
1161401659 19:4068348-4068370 GTAATAATAATCTGGCTACGAGG + Intergenic
1166224246 19:41385247-41385269 GCAATAAAGACCAGGCTTGGTGG - Intronic
927369754 2:22340773-22340795 AGAATAAAAACCTTGCTGCCAGG - Intergenic
933736288 2:85497581-85497603 GGATTAAAAAACTGGCTGCTTGG + Intergenic
935618459 2:105109007-105109029 GCAATTAAGTCCTGGCTGTGAGG + Intergenic
935881700 2:107572168-107572190 GCAGCAAAAACCTTGCTGAGAGG + Intergenic
935927690 2:108088468-108088490 ACAATAAAATCCAGGCTGAGGGG + Intergenic
938512313 2:131962835-131962857 ACAATAGAAACCTGGATGAGAGG - Intergenic
940820547 2:158351102-158351124 GCAATAAAAACCATGCTGTTTGG - Intronic
1176781449 21:13199941-13199963 ACAATAGAAACCTGGATGAGAGG + Intergenic
1177958517 21:27631233-27631255 TCAATAAAAAACTGCCTGGGAGG + Intergenic
1177979150 21:27889090-27889112 ACAATAGAAACCTGGATGAGAGG + Intergenic
1179415767 21:41197254-41197276 ACAAAAAAAACCTGGCTGGCTGG - Intronic
1181595040 22:23908605-23908627 GCATAAAAAACATGGCAGCGGGG - Intergenic
1182112421 22:27732958-27732980 GCAAAAAAGACCTGGCCGCTTGG + Intergenic
1182602025 22:31473023-31473045 GCCAAAAAAACTTGGCTTCGTGG - Intronic
1183135415 22:35882382-35882404 GCAATAAAAACCTGGCTGCGTGG + Intronic
1183794822 22:40108008-40108030 GCAAGGAAAACCTGGCTACGTGG + Intronic
951136630 3:19110708-19110730 GCAAGAAAAATCTGTCTGCTTGG - Intergenic
954405053 3:50340942-50340964 GCAATGGAAACCTGGGTGCAGGG + Intronic
959527569 3:107394683-107394705 GCAACAGAAACCTGGCAGCAAGG - Intergenic
960097962 3:113706353-113706375 GCATTCAAAACTTGGCTGCTTGG + Intergenic
964690144 3:159441456-159441478 CCAAAAAAAACCTGGCTGCTTGG - Intronic
967196740 3:187033007-187033029 ACAATATTAACCTGGCTGCAAGG - Intronic
967383662 3:188888346-188888368 GAAATAAAAGCCTGTGTGCGTGG - Exonic
970254307 4:14151442-14151464 GCATTACAATCCTGGCTGTGAGG - Intergenic
974086469 4:57266012-57266034 GCAATTGAAAGCTGGCTGGGGGG + Intergenic
985790369 5:1923734-1923756 GCAACAAAAACCTACCTGCAAGG - Intergenic
988769734 5:34420415-34420437 GCAAGATAAACCTGGCTCCTGGG - Intergenic
994764131 5:103894973-103894995 GCTAGGAAAACCTGGCTGCCAGG + Intergenic
996722248 5:126641343-126641365 GCATTCAAAACCTGGCTGTTTGG + Intergenic
998216647 5:140242749-140242771 GGGATGAAAACCTGGCTGAGTGG - Intronic
1000873897 5:166611696-166611718 ACAATAAATACCTGGATGGGAGG - Intergenic
1008120754 6:47614208-47614230 GCAATCAAAACTTGGCTGTTTGG + Intronic
1019642957 7:2114477-2114499 GAAATGAAAGCCTGGCTGCCGGG + Intronic
1022119116 7:27290078-27290100 GCAGTAAAAACATGGCTACAGGG + Intergenic
1030992986 7:116323748-116323770 GCATTCAAAACTTGGCTGTGTGG - Intronic
1031970504 7:128061649-128061671 GCAATAAAAAACTAGCAGTGAGG + Intronic
1032740546 7:134734242-134734264 GAAATAAAAATCTGGCAGCTTGG - Intergenic
1035535062 8:384612-384634 GGAATACAAACCTGGCAGCAGGG + Intergenic
1035651148 8:1266284-1266306 CCAATAAAAGCATGGCTGCTTGG - Intergenic
1039717941 8:40131408-40131430 GCAATAAAGAGTTGGCTGTGGGG + Intergenic
1040873424 8:52124717-52124739 GAAATAAAGCCCTGGCTGCTGGG - Intronic
1042842698 8:73140034-73140056 GATATAAAAACTAGGCTGCGCGG - Intergenic
1045307208 8:100968497-100968519 GAAATAAAAACGTGTCGGCGGGG - Intergenic
1046351899 8:113025878-113025900 GTAACAAAAACCTGGCTACTTGG - Intronic
1049843061 8:144786702-144786724 GAAACAAAAATCTGGCTGCCTGG + Intronic
1050069695 9:1797904-1797926 ACAATAAAGACCTGGCTGCTTGG - Intergenic
1050134898 9:2452289-2452311 GCAATTAAAACAAGGCTGAGGGG + Intergenic
1055762452 9:79623541-79623563 GCAATACAAACATGGTTGCAGGG - Intronic
1058094930 9:100848891-100848913 GCAGTAAAAACCTGGCAGAGAGG + Intergenic
1062736066 9:138138066-138138088 GCAAGAACATCCTGGCTGCCTGG + Intergenic
1187349517 X:18499663-18499685 GCAATAAAAACCAGACTGGCCGG - Intronic
1188088610 X:25934675-25934697 ACAGGAAAAACCTGGCTGAGAGG - Intergenic
1196526818 X:116737773-116737795 GCAATAAAATACTGGCAGCCAGG - Intergenic
1196894413 X:120320872-120320894 ACAATAAACACCTGGGTGAGAGG - Intergenic
1198218414 X:134577981-134578003 ACAACAAAAACCTGGCTGAGAGG - Intronic
1200098481 X:153675296-153675318 GTAATAAAAAACTGCCCGCGTGG + Intronic
1200398280 X:156003893-156003915 GCAAGAACATCCTGGCTGCTTGG + Intronic
1201864051 Y:18630467-18630489 GTAATAAAAACATGGATGTGAGG + Intergenic
1201869271 Y:18689911-18689933 GTAATAAAAACATGGATGTGAGG - Intergenic