ID: 1183135416

View in Genome Browser
Species Human (GRCh38)
Location 22:35882383-35882405
Sequence CAATAAAAACCTGGCTGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183135413_1183135416 -4 Left 1183135413 22:35882364-35882386 CCTTTCAGTGGTGTGGTTGCAAT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1183135416 22:35882383-35882405 CAATAAAAACCTGGCTGCGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258
1183135412_1183135416 -3 Left 1183135412 22:35882363-35882385 CCCTTTCAGTGGTGTGGTTGCAA No data
Right 1183135416 22:35882383-35882405 CAATAAAAACCTGGCTGCGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183135416 Original CRISPR CAATAAAAACCTGGCTGCGT GGG Intronic
901085619 1:6610400-6610422 CAATAAATATCTGGGTGCGGTGG + Intronic
903787046 1:25868248-25868270 GAATAGAAACCTTGCTGGGTGGG - Intronic
905419870 1:37834072-37834094 CAAAAAAAACCTGGGTGTGGTGG + Intronic
906372792 1:45268889-45268911 CAATAAAATCCAGGCTGAGTTGG + Intronic
907458760 1:54592902-54592924 CCACAAAAACCTGGCTGCTGAGG - Intronic
907555802 1:55343439-55343461 CAATAAAATCCAGGCTGAGGTGG + Intergenic
909096013 1:71290277-71290299 CAATGAAATCCAGGCTGAGTTGG + Intergenic
909105080 1:71397087-71397109 CAATAAAATCCAGGCTGAGGTGG + Exonic
909826093 1:80128369-80128391 CAATAAAGTCCAGGCTGAGTTGG - Intergenic
910083656 1:83372452-83372474 CAATAAAGTCCAGGCTGAGTTGG - Intergenic
912875804 1:113358413-113358435 CAACAAAAGCCTGGCTGTGGTGG + Intergenic
915922677 1:159988547-159988569 AAGAAAAAACCTGGCTGTGTTGG - Intergenic
916568152 1:166000483-166000505 CAAACAAAACCTGTCTACGTTGG - Intergenic
917161823 1:172065738-172065760 CCATAGAAACCTGACTGCTTTGG - Intronic
917849408 1:179047566-179047588 CAAAAAAAACCTTGCTGAGTTGG - Intronic
918711617 1:187737605-187737627 CAATATAATCCAGGCTGCGGTGG - Intergenic
923323076 1:232856043-232856065 CAATAACCACCTGGGTGCGGTGG + Intergenic
923687283 1:236162105-236162127 CAATAAAATCCAGGCTGAGGTGG + Intronic
1062769013 10:85236-85258 CAATAACATCCTGGCTGCCTGGG - Intergenic
1066412618 10:35188363-35188385 GAACAACAACCTGGCTGCCTGGG - Exonic
1068103277 10:52582286-52582308 CAATGAAATCCAGGCTGAGTTGG - Intergenic
1068215660 10:53978895-53978917 CAATAAAGTCCAGGCTGAGTTGG - Intronic
1068529547 10:58169552-58169574 CACTGAAAAACTGGCTGCATTGG - Intergenic
1072010074 10:91295153-91295175 CAATAAAAACTTGGAGGGGTTGG - Intergenic
1073339162 10:102731978-102732000 CCATAAAAACCTGGCTAGGTGGG + Intronic
1074025326 10:109627874-109627896 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1074785296 10:116834115-116834137 CAGCAAACACCTGGCTGAGTTGG + Intergenic
1076544084 10:131232195-131232217 CCATGAAAACATGGCTGAGTGGG + Intronic
1079014540 11:16857391-16857413 CAACAAAAGTCTGGCTGGGTTGG - Intronic
1079542542 11:21593583-21593605 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1080776158 11:35388689-35388711 CAATAAAAACATGTCTGAGTGGG - Intronic
1081199806 11:40202276-40202298 CAAAAAAAACCTGCCTACTTTGG - Intronic
1085000253 11:73027238-73027260 CAATGAAATCCAGGCTGAGTAGG + Intronic
1086721658 11:90128555-90128577 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1086848764 11:91783806-91783828 CAATAAAGACCAGGCTGAGATGG - Intergenic
1087340447 11:96898964-96898986 CAATAAAATCCAGGCTGCCCTGG + Intergenic
1087690762 11:101318174-101318196 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1088143778 11:106649943-106649965 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1092340703 12:7673384-7673406 CAAAAAAAAACTGGGTGCGGTGG + Intergenic
1092626054 12:10330141-10330163 CAAGCATAGCCTGGCTGCGTGGG - Intergenic
1093079446 12:14792540-14792562 TAAGAAAAATCTGGCTGGGTTGG + Intronic
1093299987 12:17442333-17442355 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1093681381 12:22007572-22007594 CAATGAAATCCAGGCTGCGGTGG + Intergenic
1093753611 12:22829163-22829185 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1095803535 12:46293764-46293786 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1096935354 12:55268253-55268275 CAATAAAGACCAGGCTGCGGTGG + Intergenic
1097758057 12:63428221-63428243 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1099352489 12:81591078-81591100 CAATAAAATCCAGGCTGAGGTGG + Intronic
1099760217 12:86911772-86911794 CAACAAAAACCAGGCTGAGTTGG + Intergenic
1105237461 13:18571664-18571686 CAATAGAAACCTGGATGAGAGGG + Intergenic
1105407442 13:20143894-20143916 CAAAATAAAGCTGGCTGAGTTGG - Intronic
1108270511 13:48755306-48755328 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1109334023 13:60970499-60970521 CAATAAAGTCCAGGCTGAGTTGG + Intergenic
1111472141 13:88696454-88696476 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1112102889 13:96209669-96209691 AAATAAAAGCCTGGATGGGTGGG - Intronic
1113073527 13:106446062-106446084 AAATAAAAACTGTGCTGCGTAGG - Intergenic
1113512304 13:110865968-110865990 CAATAAAGTCCAGGCTGCGGTGG - Intergenic
1114341540 14:21750579-21750601 CAACCAAAACCTGGCTCCATTGG + Intergenic
1115955007 14:38768085-38768107 CAATAAAATACTGGCAGCCTGGG + Intergenic
1116079807 14:40157268-40157290 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1116147851 14:41098998-41099020 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1118197426 14:63640761-63640783 CAATAAAAGCCTGGGCGCGGTGG - Intronic
1119199830 14:72744116-72744138 AAATAAAAATCTGTCTGCATGGG - Intronic
1119950886 14:78743971-78743993 CAATAAAATCCTGGTTGTTTAGG + Intronic
1120248006 14:82028386-82028408 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1120454579 14:84715876-84715898 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1121404145 14:93708710-93708732 CACTAAGATCCTGGCTGCCTGGG - Intergenic
1122147892 14:99704556-99704578 CAATAAAATCCTGACTCCCTTGG - Intronic
1123020373 14:105395171-105395193 CAATAAACTCCTGCCTGCGGCGG + Exonic
1123147707 14:106150091-106150113 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1125610389 15:40965506-40965528 CAATAATAACCAGGCTGGGTGGG - Intergenic
1125881292 15:43198316-43198338 CAATAAAATCCAGGCTGAGGTGG + Intronic
1128294078 15:66502700-66502722 CAACCAAAACCTGGCGCCGTTGG - Exonic
1132458112 16:35478-35500 CAAGAACATCCTGGCTGCCTGGG - Intergenic
1134713437 16:16341369-16341391 CAATAAAAATGTGGTTGTGTGGG + Intergenic
1134721307 16:16384727-16384749 CAATAAAAATGTGGTTGTGTGGG + Intronic
1134946119 16:18327157-18327179 CAATAAAAATGTGGTTGTGTGGG - Intronic
1134953382 16:18367301-18367323 CAATAAAAATGTGGTTGTGTGGG - Intergenic
1136691040 16:32029348-32029370 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1136791629 16:32972908-32972930 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1136878187 16:33881022-33881044 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1203093838 16_KI270728v1_random:1234369-1234391 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1144406392 17:14956616-14956638 AAACAAAAAACTGGCTGTGTGGG - Intergenic
1146317716 17:31821340-31821362 CAATACAAACCTGGCTTTGAAGG + Intergenic
1148578116 17:48725439-48725461 CCATAAACACTTGGCTGCGGCGG + Exonic
1149204416 17:54227415-54227437 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1149323939 17:55510612-55510634 CAACAAAAAACTGGTTGCCTTGG + Intergenic
1152962074 18:86050-86072 CAAGAACATCCTGGCTGCCTGGG - Intergenic
1153069704 18:1091060-1091082 CTATAAATACCTGGCTGTGAAGG + Intergenic
1153624816 18:7013719-7013741 CATCCAAAACCTGGCTGCTTAGG + Intronic
1154313243 18:13283557-13283579 CAATAAAATCCAGGCTGAGGTGG - Intronic
1156092678 18:33490170-33490192 CAATAAAAATCTAGCTGGGTAGG + Intergenic
1158766524 18:60457030-60457052 CAATGAAACCCTGGCTGAGGTGG - Intergenic
1159962513 18:74566635-74566657 CAATAAAATCCAGGCTGAGGTGG - Intronic
1159981951 18:74792820-74792842 CAATAAAAGCCAGGCTGCTCTGG + Intronic
1160295303 18:77631913-77631935 CAATAAAGTCCAGGCTGCGGTGG - Intergenic
1160341166 18:78090050-78090072 CCATAAGAACATGGCTGAGTGGG - Intergenic
1163477565 19:17535470-17535492 AAATAAAAACCTGGGTGCGGTGG + Intronic
1164523934 19:28999979-29000001 CAAGAACACCCTGGCTGTGTGGG - Intergenic
1164841350 19:31394800-31394822 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1167408841 19:49333183-49333205 CAACAAAAACCTGGGTGTGGTGG + Intergenic
1168257304 19:55173883-55173905 CCTTAGAAACCTGGCTGCGCAGG - Intronic
925782054 2:7390141-7390163 CAATAAAATTCAGGCTGAGTTGG - Intergenic
926225454 2:10963968-10963990 CAATGAGTCCCTGGCTGCGTGGG - Intergenic
926508037 2:13740445-13740467 CAATAAACTCCAGGCTGAGTTGG + Intergenic
927369753 2:22340772-22340794 GAATAAAAACCTTGCTGCCAGGG - Intergenic
928292368 2:30050740-30050762 CAATAAAACCTTGGCTAGGTGGG + Intergenic
928587338 2:32773822-32773844 CAATAAAAAACTAGCTCCTTTGG - Intronic
928927458 2:36594125-36594147 CAATAAAATCCAGGCTGAGGTGG - Intronic
930503799 2:52256402-52256424 CAATAAAATCCAGGCTGAGGTGG - Intergenic
932113239 2:69020969-69020991 CCATAAAAACCTGACAGCCTGGG - Intronic
932162635 2:69475896-69475918 CAGTAAAGACCTGGCTAGGTTGG + Exonic
932428384 2:71658266-71658288 CAATAAAATCCAGGCTGAGGTGG - Intronic
933006634 2:77003891-77003913 CAATAAAATCCAGGCTGAGGTGG + Intronic
933344577 2:81066662-81066684 CAATAAAATCCAGGCTGTGGTGG - Intergenic
934011988 2:87830371-87830393 CAATAAAATCCAGGCTGAGGTGG - Intergenic
935927691 2:108088469-108088491 CAATAAAATCCAGGCTGAGGGGG + Intergenic
936552544 2:113459769-113459791 CAATAAAAAGCTGGCTACTGAGG - Intronic
938512312 2:131962834-131962856 CAATAGAAACCTGGATGAGAGGG - Intergenic
938849921 2:135250082-135250104 CAATAAAATCCAGGCTGAGGTGG + Intronic
939758089 2:146138279-146138301 CAATAAAATCCAGGCTGAGGTGG - Intergenic
941844675 2:170121137-170121159 GGATGAAAACCTGGCTGCCTGGG - Intergenic
943386619 2:187209957-187209979 CAATAAAATCCAGGCTGAGGTGG + Intergenic
943483882 2:188455870-188455892 CAATAAAGTCCAGGCTGAGTTGG + Intronic
943543381 2:189244586-189244608 CAATTAAATCCAGGCTGAGTTGG - Intergenic
943880760 2:193141102-193141124 CAATAAAGTCCAGGCTGAGTTGG - Intergenic
944500836 2:200358463-200358485 CAGGAAAAACCTGGCTGCAAAGG + Intronic
946635737 2:221723860-221723882 CAATAAAATCCCGGCTGAGGTGG + Intergenic
948009035 2:234636100-234636122 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1170078861 20:12449791-12449813 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1170741726 20:19064520-19064542 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1174135171 20:48374328-48374350 CAAAAAAAACCTGCCTGATTTGG + Intergenic
1175086278 20:56461796-56461818 CAGTAAAACCCTGGCTGCTGAGG - Intergenic
1175426149 20:58868439-58868461 AAAAAAAAAGCTGGCTGCGGTGG - Intronic
1176781450 21:13199942-13199964 CAATAGAAACCTGGATGAGAGGG + Intergenic
1177133206 21:17282253-17282275 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1177497860 21:21912648-21912670 TAATAAGAACCTAGCTGAGTTGG + Intergenic
1177504440 21:22001719-22001741 CCATAAAAACCAGGCTGAGGTGG - Intergenic
1177979151 21:27889091-27889113 CAATAGAAACCTGGATGAGAGGG + Intergenic
1178456903 21:32763349-32763371 CAATAAAAACATGGTTTCCTTGG + Intronic
1178469109 21:32875842-32875864 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1178533855 21:33396696-33396718 CAGGAAAAACCTGGCAGCTTGGG - Intergenic
1179415766 21:41197253-41197275 CAAAAAAAACCTGGCTGGCTGGG - Intronic
1183135416 22:35882383-35882405 CAATAAAAACCTGGCTGCGTGGG + Intronic
949363232 3:3253785-3253807 CAATAAAATCCAGGCTGAGGTGG - Intergenic
949662256 3:6292576-6292598 CAATGAAATCCAGGCTGCGGTGG - Intergenic
953493925 3:43370587-43370609 TAAAAAAAACCTGGCTTCTTTGG + Intronic
954024620 3:47772891-47772913 CAATAAAACACTGGCTGGGCTGG - Exonic
954691615 3:52398586-52398608 TAATAAAAATATGGCTGAGTTGG - Intronic
957412723 3:79861754-79861776 CAATAAAATCCAGGCTGAGGTGG + Intergenic
957470513 3:80653080-80653102 CAATAAAATCCAGGCTGAGGTGG + Intergenic
957896403 3:86425569-86425591 CAATAAACACCAGGCTGAGGTGG - Intergenic
958600260 3:96288302-96288324 CAATAAAATCCTGGCTGAGGTGG + Intergenic
959065969 3:101657517-101657539 AAACAAAAACCTGGCAGGGTGGG + Intronic
959609649 3:108279079-108279101 CAATAAAATCCAGGCTGAGGTGG - Intergenic
959754819 3:109884420-109884442 CAATAAAATCCAGGCTGAGATGG - Intergenic
961839618 3:129697840-129697862 CAATAAAGTCCGGGCTGCGATGG - Intronic
962045681 3:131757293-131757315 CAATAAAATCCAGGCTGAGGTGG + Intronic
962358155 3:134712852-134712874 GAATATAAATCTGGCTGCCTGGG + Intronic
963022437 3:140885499-140885521 CAATAAAATCCAGGCTGAGATGG + Intergenic
963322958 3:143829342-143829364 CATGAAAAACCTGGATGCTTTGG - Intronic
966466352 3:180234531-180234553 CAATAAAATCCAGGCTGAGGTGG - Intergenic
967009449 3:185418446-185418468 CAACCAAAACCTGGCGCCGTTGG - Intronic
967622649 3:191651564-191651586 CAATAAAATCCAGGCTGAGGTGG - Intergenic
968403066 4:315536-315558 CAATAAAATCCAGGCTGTGGTGG - Intergenic
969072505 4:4550833-4550855 CAATAAAATCCAGGCTGAGGTGG + Intergenic
969996542 4:11318357-11318379 CAATAAAATCCAGGCTGAGGTGG + Intergenic
970894626 4:21087682-21087704 CGATATAAACCTGGTTGTGTTGG - Intronic
971111500 4:23591216-23591238 CAATAAAGTCCAGGCTGAGTTGG + Intergenic
974145024 4:57936570-57936592 CAATAAAGTCCAGGCTGAGTTGG + Intergenic
974477724 4:62405470-62405492 CAATAAAATCCAGGCTGAGGTGG + Intergenic
975204141 4:71624677-71624699 CAATAAAATCCAGGCTGAGGTGG - Intergenic
976057007 4:81080797-81080819 CAATAAAGTCCTGGCTGAGGTGG + Intergenic
977403441 4:96564196-96564218 GAATATAAACCTGGCTGGGGAGG + Intergenic
977972985 4:103232505-103232527 CAATAAAATCCAGGCTGAGGTGG + Intergenic
978101169 4:104842052-104842074 CAATAAAATCCAGGCTGGGGTGG - Intergenic
979645360 4:123061048-123061070 CAATAAAATCCAGGCTGAGGTGG - Intronic
980054377 4:128065743-128065765 CACTTATAACCTGGCTGCCTTGG + Intronic
980242290 4:130192051-130192073 CAATGAAATCCTGGCTGAGGTGG - Intergenic
980391800 4:132156594-132156616 CAATGAAATCCTGGCTGAGTTGG - Intergenic
981585202 4:146293516-146293538 GTATAATAACTTGGCTGCGTTGG - Intronic
981666817 4:147237410-147237432 TAATGAAAACCTTGCTGCTTGGG - Intergenic
981983502 4:150826274-150826296 CATTAAAAACCTGACTGGGCTGG - Intronic
983068209 4:163236392-163236414 CAATAAAATCCAGGCTGAGGTGG - Intergenic
983462787 4:168048043-168048065 CAATAAAATCCAGGCTGAGGTGG + Intergenic
984031737 4:174612724-174612746 CAATAAAGACCAGGCTGAGGTGG - Intergenic
984234641 4:177141621-177141643 CAATAAAATCCAGGCTGAGGTGG + Intergenic
986468024 5:8046375-8046397 CAATAAAATCCAGGCTGAGGTGG + Intergenic
986908117 5:12519911-12519933 CAATGAAAACCAGGCTGAGGTGG - Intergenic
988426941 5:31074962-31074984 CAATAAAATCCAGGCTGAGGTGG - Intergenic
988620201 5:32815481-32815503 CAATAAAATCCAGGCTGAGGTGG + Intergenic
988649342 5:33131201-33131223 CAATAAAATCCAGGCTGAGGTGG + Intergenic
988886121 5:35559779-35559801 CAATAAAATCCAGGCTGAGGTGG - Intergenic
990291175 5:54353689-54353711 CAATAAAATCCAGGCTGAGGTGG + Intergenic
992273596 5:75091372-75091394 CAATAAAATACTGGCTTTGTGGG + Exonic
993015734 5:82532587-82532609 CAATAAAATCCAGGCTGAGGTGG - Intergenic
995545172 5:113223052-113223074 CAATGAAGTCCTGGCTGCCTGGG - Intronic
996526962 5:124489873-124489895 CAATAAAATCCAGGCTGAGGTGG - Intergenic
997644877 5:135475101-135475123 CCATCAAAACCTGGCTGCTCTGG - Intergenic
998216646 5:140242748-140242770 GGATGAAAACCTGGCTGAGTGGG - Intronic
998250736 5:140550505-140550527 CAATAAAAACATCTCTGCGGTGG - Exonic
998416645 5:141951093-141951115 CACTAAAGACATGGCTGTGTGGG - Intronic
1000704789 5:164497261-164497283 CAATAACAACCTTGCTGTTTGGG - Intergenic
1000947040 5:167435780-167435802 CAATAAAATCCAGGCTGAGGTGG + Intronic
1008120755 6:47614209-47614231 CAATCAAAACTTGGCTGTTTGGG + Intronic
1010263653 6:73844420-73844442 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1010655539 6:78507101-78507123 CAATAAAACCCAGGCTGAGGTGG + Intergenic
1010845449 6:80701867-80701889 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1011870379 6:91885686-91885708 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1015815589 6:137207996-137208018 CAATAAAATCCAGGCTGAGGTGG + Intronic
1016106677 6:140171927-140171949 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1016122673 6:140363513-140363535 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1020997966 7:15288356-15288378 CCATAAAACCCTGGCTAAGTAGG - Intronic
1024438640 7:49388854-49388876 CAATAACATCCAGGCTGAGTTGG - Intergenic
1027205441 7:76094187-76094209 CAAAAAAAACCTGGGTGTGGTGG + Intergenic
1027300485 7:76828590-76828612 CAATAAAGTCCAGGCTGAGTTGG - Intergenic
1027513191 7:79109309-79109331 CAATAAAATCCAGGCTGCCAAGG + Intronic
1028138260 7:87245155-87245177 CAATAAAGTCCTGGCTGAGGTGG + Intergenic
1028314411 7:89383044-89383066 CAATAAAGTCCAGGCTGAGTTGG + Intergenic
1028745400 7:94321131-94321153 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1029675017 7:102062656-102062678 AAATAAAAAATTGGCTGGGTGGG - Intronic
1031158097 7:118134786-118134808 CAATGAAATCCAGGCTGAGTTGG + Intergenic
1031930290 7:127678607-127678629 AAACAAAAAACTGGCTGTGTTGG + Intronic
1033224890 7:139553695-139553717 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1034011376 7:147532386-147532408 CAATAAAATCCAGGCTGAGGTGG - Intronic
1035518968 8:261113-261135 CCATAAAGACCTGGCTCCATTGG + Intergenic
1035651147 8:1266283-1266305 CAATAAAAGCATGGCTGCTTGGG - Intergenic
1035951902 8:4031007-4031029 CAATGAAATCCTGGCTGAGGTGG - Intronic
1037615296 8:20513818-20513840 TAATAAAATCATGACTGCGTAGG - Intergenic
1044205704 8:89490169-89490191 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1046095457 8:109553935-109553957 CAAAAAAAACCTACCTGCTTAGG - Exonic
1046191706 8:110804063-110804085 ATATATAAACCTGGCTGCTTTGG - Intergenic
1047049786 8:121098080-121098102 CAATAAAATCCAGGCTGTGGTGG - Intergenic
1048699935 8:137077464-137077486 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1049900456 9:157412-157434 CAATAAAAAGCTGGCTACTGAGG + Intronic
1050185686 9:2970440-2970462 CAATAAAAAGCTGGCAGCCTAGG + Intergenic
1050273004 9:3966256-3966278 CAACAAAATCCTGGCTTCCTTGG + Intronic
1050623387 9:7477988-7478010 CAACCAAAACCTGGCGCCGTTGG - Intergenic
1050778996 9:9306404-9306426 AAATAAAAAACTAGCTGGGTGGG + Intronic
1051161222 9:14209899-14209921 TAAAAAAAACCTGGTTGCTTAGG + Intronic
1051902762 9:22060439-22060461 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1052143221 9:25014868-25014890 CCATAAAAAAATGGATGCGTAGG + Intergenic
1052615755 9:30838659-30838681 CAAAAATTACCTGGATGCGTTGG + Intergenic
1052666141 9:31497444-31497466 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1053743502 9:41167713-41167735 CAATAAAAAGCTGGCTACTGAGG + Intronic
1054348775 9:63997514-63997536 CAATAAAAAGCTGGCTACTGAGG + Intergenic
1054446505 9:65323899-65323921 CAATAAAAAGCTGGCTACTGAGG + Intergenic
1054483770 9:65697610-65697632 CAATAAAAAGCTGGCTACTGAGG - Intronic
1054684842 9:68263563-68263585 CAATAAAAAGCTGGCTACTGAGG - Intronic
1055341993 9:75293674-75293696 CAATAAAATCCGGGCTGAGGAGG - Intergenic
1057316562 9:93972665-93972687 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1057453762 9:95189251-95189273 CAATAAAAACCTAACTGCCCTGG + Intronic
1062736067 9:138138067-138138089 CAAGAACATCCTGGCTGCCTGGG + Intergenic
1186075817 X:5877137-5877159 CAGTAAAATCCAGGTTGCGTTGG + Intronic
1188749166 X:33884582-33884604 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1189962530 X:46338168-46338190 CAAAACAAACATGGCTGGGTGGG + Intergenic
1191607758 X:63080681-63080703 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1191746270 X:64491423-64491445 CAATAAATTCCTGGCTGAGGTGG + Intergenic
1192132708 X:68567953-68567975 CAATGAAATCCAGGCTGAGTTGG - Intergenic
1192742354 X:73905530-73905552 CAATAAAGTCCAGGCTGAGTTGG + Intergenic
1193027155 X:76856635-76856657 CAATAAAATCCTGGCTGAAGTGG - Intergenic
1193777086 X:85656750-85656772 CAATGAAATCCAGGCTGAGTTGG + Intergenic
1194548606 X:95269487-95269509 CAATAAAATCCAGGCTGAGGTGG - Intergenic
1195815363 X:108878975-108878997 CAATAAAGACCAGGCTGAGTTGG - Intergenic
1196546793 X:116972900-116972922 CAATGAAAACCAGGCTGAGGAGG + Intergenic
1197499012 X:127221599-127221621 CAATAAAACCCAGGCTGAGATGG + Intergenic
1197910892 X:131481781-131481803 TAATAAAATCCAGGCTGAGTTGG + Intergenic
1198707131 X:139461674-139461696 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1198951774 X:142080238-142080260 CAATAAAGTCCAGGCTGAGTTGG - Intergenic
1199112044 X:143946628-143946650 CAATAAAATCCGGGCTGAGGTGG + Intergenic
1199132497 X:144208174-144208196 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1199310139 X:146312115-146312137 CAATAAAACCCTGGCTGACGTGG - Intergenic
1199317671 X:146399989-146400011 CAATAAAAAGCAGGCTGAGGTGG + Intergenic
1199357084 X:146875186-146875208 CAATAAAATCCAGGCTGAGGTGG + Intergenic
1199690011 X:150302394-150302416 CAATATAAATCTGGCTGTGTTGG + Intergenic
1200398281 X:156003894-156003916 CAAGAACATCCTGGCTGCTTGGG + Intronic