ID: 1183135418

View in Genome Browser
Species Human (GRCh38)
Location 22:35882392-35882414
Sequence CCTGGCTGCGTGGGTTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183135413_1183135418 5 Left 1183135413 22:35882364-35882386 CCTTTCAGTGGTGTGGTTGCAAT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1183135418 22:35882392-35882414 CCTGGCTGCGTGGGTTTAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1183135412_1183135418 6 Left 1183135412 22:35882363-35882385 CCCTTTCAGTGGTGTGGTTGCAA No data
Right 1183135418 22:35882392-35882414 CCTGGCTGCGTGGGTTTAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183135418 Original CRISPR CCTGGCTGCGTGGGTTTAAG AGG Intronic
900310949 1:2032860-2032882 CCTGGCTGCGTGGGTGCCCGAGG - Intergenic
900902729 1:5527814-5527836 CCTGCCTGTGTGGCTTTCAGAGG - Intergenic
901029676 1:6299698-6299720 CGTGTGTGCGTGTGTTTAAGGGG + Intronic
901112055 1:6805588-6805610 CTTGCCTGCCTGGGCTTAAGCGG + Intronic
907240154 1:53076834-53076856 CCAGGCTGCGTGGGGTTGACAGG + Intronic
907982026 1:59492530-59492552 CCTGGCTGCTGGAGTTCAAGGGG + Intronic
909720778 1:78767307-78767329 CCTGGTGGCGTGGGCTTATGAGG - Intergenic
914396712 1:147276452-147276474 CTTGGCTGTTTGGGTTTGAGCGG + Intronic
919753848 1:201054413-201054435 CCTGGCTGCGTGGATTGCATGGG - Intronic
920453930 1:206083303-206083325 CCTGGCTGCGTGTGTATTTGTGG + Intronic
922339127 1:224641413-224641435 CCTGGGTGCCTGGGATGAAGAGG - Intronic
922796374 1:228341687-228341709 CCTGCCTGGGTGGGTGTGAGGGG + Intronic
923870513 1:237988564-237988586 CCTGGCTGAGTGGGTTAATGTGG + Intergenic
924181333 1:241441369-241441391 CCTGGCTGGGTGGGGTTGAGTGG - Intergenic
1062795770 10:344026-344048 CCTGGCTGCTTTTCTTTAAGTGG - Intronic
1062979939 10:1713493-1713515 CATGGCTCCGTGGGTGTAAATGG + Intronic
1066088210 10:31991629-31991651 TCTGCCTGCCTAGGTTTAAGGGG + Intergenic
1069340383 10:67402727-67402749 CCTGGTGGAGTGGGTTTATGAGG - Intronic
1071566691 10:86674864-86674886 CCTGCCTGGGTGGGTTGGAGGGG - Intronic
1076348820 10:129800776-129800798 CCTGCCTGCTTGAGGTTAAGGGG - Intergenic
1077036136 11:495366-495388 TCTGGCTGCGTGGGCTTCAAAGG + Intronic
1080108794 11:28542094-28542116 CCTGCCCTCTTGGGTTTAAGTGG - Intergenic
1081995409 11:47360524-47360546 CCTGGCTGGGAGGTTTTAACAGG - Intronic
1084531525 11:69730593-69730615 CCTGGCTGGGTGGGTTCCACAGG + Intergenic
1085189242 11:74603546-74603568 CCTGTCTGCCTGGGTCTGAGGGG - Intronic
1092067879 12:5607163-5607185 CCTGGCTCAGTGGCTTTTAGTGG - Intronic
1097406638 12:59197744-59197766 CCTGGTAGCATGGGTTTATGAGG - Intergenic
1121123240 14:91389520-91389542 CTTGGCTGCTGGGGCTTAAGAGG + Intronic
1130841013 15:87701324-87701346 CCTGGCAGAGTGGGTCTAGGGGG - Intergenic
1135717749 16:24787072-24787094 CCAGAATGCTTGGGTTTAAGAGG - Intronic
1137529444 16:49268758-49268780 CCTGGCTGTGTGACTTTAGGTGG - Intergenic
1139602124 16:67993319-67993341 CCTGGCGGCGTGGCCTCAAGAGG + Exonic
1140404078 16:74696108-74696130 GCTGGATGCGTGGGGTGAAGCGG + Intronic
1144485102 17:15657870-15657892 CCTGAATGCTTGGGGTTAAGAGG - Intronic
1148063967 17:44855265-44855287 CCTGGCTGTTTGTTTTTAAGAGG - Intronic
1148159306 17:45441136-45441158 CCTGGCTGTGTGTGTTTACATGG + Intronic
1150390643 17:64788220-64788242 CCTGGCTGTGTGTGTTTACATGG + Intergenic
1151487228 17:74408581-74408603 CATGGTTGCGTGGGTTGATGGGG - Intergenic
1156374541 18:36501500-36501522 TCTGGCTGCGTGGGTTTTTCTGG + Intronic
1156933078 18:42668878-42668900 CCTGAATGCTTGGGTTAAAGTGG + Intergenic
1159881717 18:73864702-73864724 CCTGGCAGTGCAGGTTTAAGAGG - Intergenic
1163118502 19:15201729-15201751 CCTGGCTGAGTGAGTTTTAGCGG - Intergenic
1163261139 19:16190752-16190774 CCTGGCAGGGTGAGTTTGAGAGG + Intronic
1165341268 19:35213931-35213953 CCTTGCTGCGTGGGCTCAACAGG - Intergenic
1166543326 19:43619771-43619793 CCTCGCTGCCTGGGTTTACTTGG + Exonic
1166988187 19:46674843-46674865 ACTGGCTGGGTGGGTTGCAGAGG - Intronic
1167100297 19:47400526-47400548 CCAGGCTGCCTGGGTTCAAATGG + Intergenic
932447768 2:71791266-71791288 CCTGGCTGGGAGGGCTTCAGGGG + Intergenic
934504581 2:94880426-94880448 CCTGGATGCCTGGGCTTATGTGG - Intergenic
935395988 2:102609707-102609729 CCTTGCTGCTGGGGTGTAAGTGG + Intergenic
937284106 2:120739063-120739085 CCTGGCTGCGGGGGTCTTGGGGG + Intronic
941176332 2:162201583-162201605 CCTGGCTGCAAGGGTTAGAGAGG - Intronic
945001610 2:205356804-205356826 CCCTGCTTCCTGGGTTTAAGCGG - Intronic
1171852651 20:30319569-30319591 CTTGGCTGGGTGGGGTTTAGGGG - Intergenic
1172620458 20:36315431-36315453 GCTGGCTGCGTGGGCTTCATGGG + Intronic
1173579408 20:44136602-44136624 CCTGGCTGTGTGGATTTGACGGG - Intronic
1173944881 20:46942673-46942695 CCTGGCTTGGTGAGGTTAAGTGG - Intronic
1178306311 21:31493639-31493661 CCAGGCTGCCTTGGTTTGAGAGG + Intronic
1179395779 21:41039178-41039200 GCTGGCTGCTTGGGTGAAAGGGG - Intergenic
1179416606 21:41203514-41203536 CCTGGCTGCGAGGGTGAATGAGG + Intronic
1181021726 22:20107025-20107047 CTCGGCTGCGTGGCTTTGAGTGG + Intronic
1181159999 22:20954289-20954311 CCTGGCTGAGGGGGTGTCAGTGG - Intergenic
1182429893 22:30293216-30293238 CCTGGGTGGGTGACTTTAAGGGG + Intronic
1183135418 22:35882392-35882414 CCTGGCTGCGTGGGTTTAAGAGG + Intronic
1184724984 22:46338860-46338882 CCTGCCTGAGTGGGCTTTAGGGG + Intronic
969224077 4:5783025-5783047 CTTGGCTGAGTGGGGTTGAGAGG + Intronic
969463776 4:7342947-7342969 CCTGGCTGTGTGGCCTTCAGAGG + Intronic
971168457 4:24208404-24208426 CCTGGCTGCATGGGATAAAGTGG + Intergenic
973940477 4:55904779-55904801 CCTAGCTGCTTGTGTTTGAGTGG + Exonic
978821572 4:112972561-112972583 CCTGGGTGAGAAGGTTTAAGAGG + Intronic
983646594 4:169997687-169997709 CCTGGCTGGGTAGGTATAAGGGG + Intronic
990931401 5:61095678-61095700 CCTGGTGGAGTGGGTTTAGGAGG + Intronic
991311348 5:65246311-65246333 CCTTGCTGCCTTGTTTTAAGAGG - Intronic
993226376 5:85170183-85170205 CCTGGCTGAGTGGGTTCATGAGG + Intergenic
999714736 5:154351598-154351620 CCTGGCTCCTTTGGTTTGAGTGG + Intronic
1001848454 5:174941914-174941936 CCTGGCTCCATGGTTTTCAGTGG - Intergenic
1001998035 5:176177694-176177716 CCTGGACGCGTGTGTTGAAGAGG - Intergenic
1002312835 5:178325076-178325098 CCTGACTGCGTGACTTTGAGCGG - Intronic
1002556371 5:180044997-180045019 CCTGGCTGCGCAAGTTTCAGGGG - Intronic
1004252502 6:14033761-14033783 CCAGGCAGCGAGGGTTAAAGGGG - Intergenic
1007215503 6:40234496-40234518 CCTGGTAGAGTGGGTTCAAGAGG - Intergenic
1017240419 6:152162093-152162115 CCTGGCTGGCTGGGCTTAGGAGG + Intronic
1019429723 7:993126-993148 GCTGGCTGCGTGGGTTTCACAGG - Intergenic
1025773963 7:64541806-64541828 CCTGCCTGCGTGGCTATAAATGG - Intronic
1027220054 7:76208166-76208188 CCTGGCGGGGTGGGCTTAGGGGG + Intronic
1034776025 7:153827794-153827816 CCTGACTGTGTGGGTAGAAGTGG - Intergenic
1037041664 8:14244064-14244086 CCAGGCTACATGGGTTTAAGTGG + Intronic
1039392780 8:37195332-37195354 CCTGGCTACATGGGTAGAAGAGG - Intergenic
1041009696 8:53529693-53529715 CCTGGCAGCGGGGGTGTATGAGG + Intergenic
1041639045 8:60177127-60177149 TCTGGCTGTATGGGTTGAAGAGG + Intergenic
1044117305 8:88350714-88350736 CCTGGCGGCATGGGTTCACGAGG + Intergenic
1047495680 8:125407022-125407044 CCTGGATGGGTGGGTGGAAGTGG + Intergenic
1056307600 9:85305375-85305397 TCTGGCTGAGTTGGTTTAACAGG - Intergenic
1056467854 9:86876632-86876654 AATGGGTGCGTGGGTTTAAGTGG - Intergenic
1062597491 9:137305835-137305857 CCTGCCTGGCAGGGTTTAAGAGG - Intergenic
1062721985 9:138049471-138049493 CGGGGCTGCGTGGGGTTAGGAGG + Intronic
1188873550 X:35402548-35402570 TCTGGCTTCTTGGGTTTATGTGG - Intergenic
1192153714 X:68727580-68727602 CCTGGCTGTGTGACCTTAAGTGG + Intergenic
1196409124 X:115397244-115397266 CCTGGGTGCCTGGGTTACAGAGG + Intergenic