ID: 1183136469

View in Genome Browser
Species Human (GRCh38)
Location 22:35893805-35893827
Sequence GGAACCTACTTGGCTAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183136469_1183136480 19 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136480 22:35893847-35893869 GCTGAAGGGCAAAGGGCAAAGGG 0: 1
1: 0
2: 7
3: 66
4: 507
1183136469_1183136474 4 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136474 22:35893832-35893854 ATTCCAGACATCTGGGCTGAAGG 0: 1
1: 0
2: 0
3: 30
4: 207
1183136469_1183136477 11 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136477 22:35893839-35893861 ACATCTGGGCTGAAGGGCAAAGG 0: 1
1: 0
2: 3
3: 47
4: 885
1183136469_1183136475 5 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136475 22:35893833-35893855 TTCCAGACATCTGGGCTGAAGGG No data
1183136469_1183136471 -4 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136471 22:35893824-35893846 TTCCTGCAATTCCAGACATCTGG 0: 1
1: 0
2: 1
3: 15
4: 341
1183136469_1183136479 18 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136479 22:35893846-35893868 GGCTGAAGGGCAAAGGGCAAAGG 0: 1
1: 1
2: 12
3: 59
4: 595
1183136469_1183136472 -3 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136472 22:35893825-35893847 TCCTGCAATTCCAGACATCTGGG 0: 1
1: 0
2: 1
3: 14
4: 432
1183136469_1183136478 12 Left 1183136469 22:35893805-35893827 CCTGTGTTAGCCAAGTAGGTTCC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1183136478 22:35893840-35893862 CATCTGGGCTGAAGGGCAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183136469 Original CRISPR GGAACCTACTTGGCTAACAC AGG (reversed) Intronic
902709603 1:18229778-18229800 GGGAACTGCTTGGCTGACACAGG + Intronic
908074645 1:60502740-60502762 GAAACCTATTTGGCTATCTCAGG + Intergenic
908993737 1:70127046-70127068 GGAACTTTCTTGGGTAACGCAGG + Intronic
913102935 1:115586023-115586045 GGAACATACTTGGCTTTCTCTGG + Intergenic
914926918 1:151896760-151896782 GGAAGCTACTAGGGTAACTCAGG + Intronic
915582605 1:156823991-156824013 GGAACCTACTTGCCTCATCCAGG - Intronic
919177534 1:194037092-194037114 GCAACCTACTTGTCTGACAAAGG - Intergenic
921636446 1:217500371-217500393 GGAACTTCCTTGGCTCTCACTGG + Intronic
1062938050 10:1402464-1402486 GGAAGCCACTTAGCTCACACAGG + Intronic
1069461006 10:68594623-68594645 GGAACCTGAAAGGCTAACACTGG - Intronic
1070846637 10:79527733-79527755 GAACCCTTCCTGGCTAACACGGG + Intergenic
1070927158 10:80232535-80232557 GAACCCTTCCTGGCTAACACAGG - Intergenic
1071039445 10:81288470-81288492 GGAACCCATTAGGCTAACAGTGG + Intergenic
1073844345 10:107536592-107536614 GGAACATACTTGTTTATCACAGG + Intergenic
1076100616 10:127774735-127774757 GGAGTCTACTTGGCTAAGACTGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085191598 11:74630180-74630202 GGAACCTACTGAGCTATCAAAGG + Intronic
1090335343 11:125958895-125958917 GTAACTTGATTGGCTAACACAGG + Exonic
1090350353 11:126104090-126104112 GGAACCTACCTGACTCACACAGG + Intergenic
1091776133 12:3185996-3186018 GGACCCTACATGGCTAACCCTGG - Intronic
1098637303 12:72800290-72800312 GGACTGTACTTGGCTAAAACAGG - Intergenic
1108110368 13:47065129-47065151 GAAACCTACTTGACTCACAAGGG - Intergenic
1113640471 13:111953578-111953600 GGAACCTACTCGGCCAAGGCCGG - Intergenic
1116051992 14:39815099-39815121 GGAGGCTACTTGGAGAACACTGG - Intergenic
1133455370 16:5937279-5937301 TGAACAAACTTGGCAAACACTGG + Intergenic
1134327007 16:13216621-13216643 GGAACCTACTTTGGGAACATAGG + Intronic
1138824596 16:60303894-60303916 GAAACCATCCTGGCTAACACGGG + Intergenic
1139108589 16:63860928-63860950 GAGACCATCTTGGCTAACACGGG - Intergenic
1140329323 16:74038091-74038113 AGAAACTACATGGCTAACAATGG + Intergenic
1140519502 16:75569103-75569125 GGAACCTATTTGGACAACATTGG - Intronic
1152058598 17:78051610-78051632 GGATCCTACTTTGCTCTCACTGG - Intronic
1157340387 18:46772672-46772694 GGACCCTACTGGGATGACACTGG + Intergenic
1166662298 19:44654892-44654914 GTAACCTACTTGGTTATCTCTGG + Intronic
926800577 2:16656543-16656565 GGAAGCTACATGGCTATCACTGG + Intronic
935150917 2:100434854-100434876 TGGACCTACTTGAGTAACACTGG - Intergenic
936604325 2:113933879-113933901 GAGACCTTCCTGGCTAACACGGG - Intronic
939121866 2:138126819-138126841 TGGACCTACCTGGCTAACCCAGG - Intergenic
944397150 2:199281086-199281108 AGAACCTACTTGACTATCAAGGG + Intronic
945856672 2:215077065-215077087 GGAACCTACTAGGTTTACACAGG + Intronic
948652239 2:239455608-239455630 GGACCCTACACGGCTATCACAGG - Intergenic
1169328250 20:4694767-4694789 GGAACCTGCATGGCTATCAGAGG - Intronic
1171362513 20:24598009-24598031 GGTTCCAATTTGGCTAACACAGG - Intronic
1172395748 20:34603478-34603500 GAAACCTACTTGGCTAAATTAGG - Intronic
1173746511 20:45441534-45441556 GGAATCTCCTTGGCTGAGACAGG + Intergenic
1174807555 20:53617576-53617598 GAGACCAACCTGGCTAACACGGG + Intergenic
1179418526 21:41217454-41217476 GGAAGTTGCTTGGCTAAAACGGG - Intronic
1181673362 22:24436459-24436481 GGAACCTGTTGGGCTAGCACAGG + Intronic
1183136469 22:35893805-35893827 GGAACCTACTTGGCTAACACAGG - Intronic
951879449 3:27465756-27465778 GAAACCACCCTGGCTAACACGGG + Intronic
956093361 3:65691099-65691121 GAGACCATCTTGGCTAACACGGG + Intronic
957456891 3:80462785-80462807 GAGACCATCTTGGCTAACACGGG - Intergenic
958991190 3:100847602-100847624 TGAACCTACATGGACAACACCGG - Exonic
961171663 3:124801749-124801771 GGAACCCACTTGCCAAACAATGG + Intronic
962094040 3:132275430-132275452 GCAACCTACTTATCTAACAAAGG - Intronic
974002288 4:56523784-56523806 GGAACCTACCTGACTAAGAATGG + Exonic
975513146 4:75215909-75215931 GCAACCTACTTGTCTGACAAAGG - Intergenic
977519057 4:98057614-98057636 GGAACCAACTTGGAAAACATAGG + Intronic
979934210 4:126671294-126671316 GGAACCAAGTTGGAAAACACAGG + Intergenic
983325393 4:166248844-166248866 TGAACCTACTTGCCTATCTCTGG + Intergenic
986471998 5:8085118-8085140 GCAACCTACTTGTCTGACAAAGG - Intergenic
990627539 5:57631475-57631497 GGAACCTACTTACCTGACAAAGG - Intergenic
992647606 5:78826892-78826914 GGAACCTATTTGGCTGCCATGGG + Intronic
995597410 5:113762862-113762884 GGAACCAACGCTGCTAACACTGG + Intergenic
995935100 5:117501442-117501464 TTAACATACTTGGCTATCACAGG - Intergenic
997601199 5:135139782-135139804 GGGACCCACTTGGAAAACACAGG + Intronic
1002461597 5:179376428-179376450 GAGACCATCTTGGCTAACACGGG + Intergenic
1003390620 6:5709849-5709871 AAAACCCACTTGGCTAACAAGGG - Intronic
1005970385 6:30756369-30756391 GAGACCATCTTGGCTAACACGGG - Intergenic
1007303378 6:40885596-40885618 GGAAACTACAGGGCAAACACCGG + Intergenic
1009278801 6:61720680-61720702 GCAACCTACTCGTCTAACAAAGG - Intronic
1010319548 6:74489910-74489932 GCAACCTACTTGTCTGACAAAGG + Intergenic
1012962943 6:105641905-105641927 GGAACTTACTTGCCTGACTCAGG - Intergenic
1021631114 7:22648545-22648567 GGGACCTACCTGGATAACCCAGG + Intergenic
1023322675 7:39016298-39016320 GAACCCTACTTGGCTCACAGTGG - Intronic
1026347461 7:69486768-69486790 GGCACATCCTTGGCTATCACTGG - Intergenic
1028458930 7:91069994-91070016 GCAACCAGCTTGGCCAACACAGG - Intronic
1032782744 7:135177258-135177280 GGAACTAACTTGACTACCACTGG - Intergenic
1033240597 7:139676267-139676289 GGACCCTAGTTTGCTAACCCTGG + Intronic
1033495359 7:141888635-141888657 GAGACCATCTTGGCTAACACAGG - Intergenic
1033677759 7:143560672-143560694 GGGTCCTACTTGGCTCACAACGG - Intergenic
1033694077 7:143768765-143768787 GGGTCCTACTTGGCTCACAACGG + Intergenic
1038367700 8:26953399-26953421 GGAACTCACTTTTCTAACACAGG - Intergenic
1038802259 8:30759753-30759775 GAGACCATCTTGGCTAACACGGG + Intronic
1039195134 8:35022505-35022527 GGGACCTAATTGTCTAACATGGG + Intergenic
1044345346 8:91098192-91098214 GGAAACTACTTGGCAAACATGGG + Intergenic
1047518021 8:125572112-125572134 TGCAGCTACTTGGCTAACATTGG - Intergenic
1050966059 9:11804119-11804141 GCAACCTACTTGTCTGACAAAGG - Intergenic
1055185716 9:73451149-73451171 AGAGCCTACTTGGCTTACAATGG - Intergenic
1059416647 9:114166677-114166699 GGAGCCTGCTTTGCCAACACTGG + Intronic
1187635634 X:21225017-21225039 GCAACCTAATTTACTAACACTGG + Intergenic
1196924040 X:120614283-120614305 GGAAGTTACTTGGTAAACACAGG + Intronic
1197370416 X:125620054-125620076 GGAACCCATTAGGCTAACAGTGG - Intergenic
1199195546 X:145025483-145025505 GGATGATACTTAGCTAACACAGG + Intergenic
1200334985 X:155341003-155341025 GCAACCTACTTGTCTGACAAAGG - Intergenic
1200351481 X:155500218-155500240 GCAACCTACTTGTCTGACAAAGG + Intronic
1201245410 Y:11998478-11998500 GCAACCTACTTGTCTGACAAAGG - Intergenic
1201618082 Y:15923999-15924021 GAGACCAACCTGGCTAACACGGG - Intergenic
1202093596 Y:21220168-21220190 GCAACCTACTTATCTAACAAAGG + Intergenic