ID: 1183136854

View in Genome Browser
Species Human (GRCh38)
Location 22:35897345-35897367
Sequence TCAATGGCCTTGAGTTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183136849_1183136854 27 Left 1183136849 22:35897295-35897317 CCTCAATTTCAGCAGACAGCCAG 0: 2
1: 0
2: 1
3: 9
4: 193
Right 1183136854 22:35897345-35897367 TCAATGGCCTTGAGTTCCAGTGG No data
1183136850_1183136854 8 Left 1183136850 22:35897314-35897336 CCAGCAGTAAGTGTGATGAAGCC 0: 1
1: 0
2: 1
3: 12
4: 85
Right 1183136854 22:35897345-35897367 TCAATGGCCTTGAGTTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183136854 Original CRISPR TCAATGGCCTTGAGTTCCAG TGG Intronic
No off target data available for this crispr