ID: 1183137535

View in Genome Browser
Species Human (GRCh38)
Location 22:35903603-35903625
Sequence AAACTCAACATGCCCAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183137534_1183137535 12 Left 1183137534 22:35903568-35903590 CCAATATGACTACTTAGCTGTCA 0: 1
1: 0
2: 1
3: 3
4: 102
Right 1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG 0: 1
1: 0
2: 7
3: 47
4: 207
1183137533_1183137535 19 Left 1183137533 22:35903561-35903583 CCATGCTCCAATATGACTACTTA 0: 1
1: 0
2: 0
3: 18
4: 143
Right 1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG 0: 1
1: 0
2: 7
3: 47
4: 207
1183137531_1183137535 21 Left 1183137531 22:35903559-35903581 CCCCATGCTCCAATATGACTACT 0: 1
1: 0
2: 0
3: 22
4: 201
Right 1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG 0: 1
1: 0
2: 7
3: 47
4: 207
1183137530_1183137535 26 Left 1183137530 22:35903554-35903576 CCTCTCCCCATGCTCCAATATGA 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG 0: 1
1: 0
2: 7
3: 47
4: 207
1183137532_1183137535 20 Left 1183137532 22:35903560-35903582 CCCATGCTCCAATATGACTACTT No data
Right 1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG 0: 1
1: 0
2: 7
3: 47
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183137535 Original CRISPR AAACTCAACATGCCCAAAAT TGG Intronic
902126733 1:14220278-14220300 AAAATTGATATGCCCAAAATTGG + Intergenic
902321293 1:15668799-15668821 AAACTCAGGAATCCCAAAATTGG + Exonic
903618068 1:24676681-24676703 AAAATTAACATGTCCAAAATAGG + Intergenic
904363495 1:29994225-29994247 AAACTCAGCAAACCCAAACTGGG + Intergenic
905501264 1:38440072-38440094 AAACTCAATAAGCCTTAAATAGG - Intergenic
907774277 1:57498175-57498197 GAATTCAACATACCCAAAACAGG - Intronic
908434891 1:64095778-64095800 AAACTCAACATTCTTAAAACTGG + Intronic
908666310 1:66495213-66495235 AGACTCAATATGCTCAAAAATGG + Intergenic
911588157 1:99714827-99714849 AGACTTAACATGTCCAAAATGGG - Intronic
912326772 1:108771056-108771078 AAACACAACATTACCAAAATCGG - Intronic
915993121 1:160537384-160537406 AAACTCAACAAGCTGAATATAGG - Intergenic
916123354 1:161548814-161548836 ATACTGAACAGGCCAAAAATGGG - Intronic
916133246 1:161630171-161630193 ATACTGAACAGGCCAAAAATGGG - Intronic
917343582 1:174005603-174005625 AAACACAACATGCCTAAATTTGG + Intronic
917511289 1:175671200-175671222 AAACCCAACATGTCCAAAGCTGG - Intronic
918685113 1:187404881-187404903 TAGCTCAACATTCCCAAAGTGGG + Intergenic
918864354 1:189875319-189875341 AAAGTAAACATCCCCAAACTTGG + Intergenic
918869398 1:189949565-189949587 AAATTCATCTTGCCCCAAATTGG + Intergenic
919153206 1:193726586-193726608 TAACTAAAAATGACCAAAATTGG - Intergenic
919796945 1:201326644-201326666 AAACTCAACCTCTCCAAATTGGG - Intronic
919934114 1:202240465-202240487 AAACTCAACATGTCCCAGAGGGG - Intronic
921686114 1:218091038-218091060 CAGCTCAACATATCCAAAATTGG - Intergenic
921808632 1:219485728-219485750 AAACCCAACATACCCAAAGTAGG - Intergenic
922942644 1:229481131-229481153 GAACTCATCCTGCCCAACATGGG - Intronic
923521945 1:234741644-234741666 CAACTCAACATGCCCGAAACTGG - Intergenic
1063901672 10:10739430-10739452 AAAATTAAAATGCCCAAAAATGG - Intergenic
1065026603 10:21544815-21544837 AAAACCAACATGCCCAAAACAGG - Intronic
1065308753 10:24394227-24394249 AAACTCAGCAGGCTGAAAATAGG - Intronic
1065555096 10:26907114-26907136 AATCCCAGCGTGCCCAAAATTGG - Intergenic
1066550216 10:36547664-36547686 AAACTTAACATGTCCAGACTGGG + Intergenic
1068859234 10:61830021-61830043 AAACTCAAGATGGCCAAAGATGG + Intergenic
1070169836 10:73924694-73924716 AAAGTCAACCTGCCCCAAACTGG + Intergenic
1071696806 10:87884391-87884413 AAAGTAAACATGGCCAATATAGG - Intronic
1072541938 10:96405219-96405241 AAAGTCAACTTACCCAAAAGGGG + Exonic
1072609775 10:97010457-97010479 GAAATCAACATGTTCAAAATTGG + Intronic
1074968515 10:118515797-118515819 AATCTTAACAAGCCCCAAATAGG - Intergenic
1076338859 10:129728922-129728944 AATCTTAACATGCCCACACTGGG + Intronic
1077621822 11:3731735-3731757 ATACTCAACATGTACAAAGTTGG - Intronic
1077918443 11:6625869-6625891 AAACTGGACAGGCCCAAGATGGG + Intronic
1078128855 11:8594941-8594963 AAACTCAAAATGGTCATAATGGG + Intergenic
1078644144 11:13123473-13123495 AAACTCCACATGGCCAAAACTGG + Intergenic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079486375 11:20939848-20939870 AAACTCAACATGCCTAAACCTGG - Intronic
1079503404 11:21128036-21128058 AAACTCAACCAGCCCAACACAGG + Intronic
1079663310 11:23070007-23070029 AAAGTTAACCTGACCAAAATTGG + Intergenic
1080060728 11:27954022-27954044 GAACTCAACATGTCAATAATTGG - Intergenic
1081170516 11:39864200-39864222 AAACTCAAAATACTCAAATTAGG - Intergenic
1083081376 11:60097160-60097182 AAACTTCACATGCCTATAATTGG + Intronic
1083790352 11:64980783-64980805 AAATTTAACATGGCCAAAATAGG + Intergenic
1083984451 11:66203168-66203190 AAAATCAACATACAGAAAATAGG + Intronic
1084848494 11:71919587-71919609 AAAACCAACCTGGCCAAAATGGG - Intronic
1086314562 11:85577523-85577545 AAACTTATCATGGCCAAAACTGG - Intronic
1086945880 11:92843638-92843660 AGACTCAACATGCCCACAACAGG - Intronic
1088406832 11:109490795-109490817 AAACTCTAGAAGCCCCAAATAGG + Intergenic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1095230421 12:39732781-39732803 AAACTCAAAATGCCCATATTTGG + Intronic
1095869707 12:47012887-47012909 AAACTGAACATGCCCTTATTTGG - Intergenic
1098020972 12:66156251-66156273 AAACTTAACATGGCCAAAACTGG + Intronic
1098987890 12:77031889-77031911 AAACTGAACATGCCCACCCTGGG + Intronic
1099423862 12:82499193-82499215 AAACTCAACATACACAAAATAGG - Intergenic
1099985395 12:89657073-89657095 AAAGTTAACATGCCCAACAATGG + Intronic
1101049644 12:100847935-100847957 AATCTCAACTGGCCTAAAATGGG - Intronic
1102238214 12:111308050-111308072 AAACTCAAGCTGGCCAGAATGGG + Intronic
1107635991 13:42393121-42393143 AGACTCAATATCCCCAAATTTGG + Intergenic
1108941299 13:55958031-55958053 AAACTCAACATGACCTAAAGTGG + Intergenic
1109771019 13:66973378-66973400 AAAATCAAGATGCCCAAACATGG + Intronic
1112569922 13:100584915-100584937 AAGCTCAACATTACCAAAATAGG - Intronic
1112662593 13:101529524-101529546 AAACTATACTTGCCAAAAATAGG - Intronic
1118956220 14:70483574-70483596 AAACTCAAAATTGGCAAAATTGG + Intergenic
1121134944 14:91488513-91488535 AAGATCAACATGCCAAAAATTGG + Intronic
1121235849 14:92390769-92390791 CAACTCAAGATTCCTAAAATAGG - Intronic
1121484034 14:94300114-94300136 AAATTCAACAAGCCCAAAGCAGG - Intergenic
1122463133 14:101912186-101912208 AAATTTAACATGTCCAAGATTGG - Intronic
1126671818 15:51122596-51122618 AAACTCAAAATGCCCATATTTGG + Intergenic
1128671714 15:69578644-69578666 AACCTCAGCATCACCAAAATTGG - Intergenic
1129550955 15:76448475-76448497 AAACTTAGCATGCCCAGAACTGG - Intronic
1136749877 16:32625158-32625180 AAGCTCAACAAACTCAAAATAGG - Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1137246729 16:46711882-46711904 AAACTCCAGTTGCCCACAATCGG + Intronic
1138038826 16:53639196-53639218 AAAGTAAACATGGCCAATATAGG + Intronic
1140567870 16:76065238-76065260 AAACCCAACATGCTCAGAACAGG + Intergenic
1203052011 16_KI270728v1_random:884356-884378 AAGCTCAACAAACTCAAAATAGG - Intergenic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1143314213 17:6019566-6019588 AAATTTAACATCACCAAAATTGG - Intronic
1143561298 17:7696838-7696860 AAACTCAATTTGTCCATAATAGG - Intronic
1143977284 17:10839107-10839129 GAACTCAAGATGCCAAATATGGG - Intergenic
1144137124 17:12306982-12307004 AAACTAAACATTACTAAAATAGG - Intergenic
1144528086 17:16008279-16008301 ATACTTAACATGTCCAAAATAGG + Intronic
1144965022 17:19071583-19071605 AATCTGAACATGCACAAAAGTGG - Intergenic
1144982945 17:19180595-19180617 AATCTGAACATGCACAAAAGTGG + Intergenic
1144985278 17:19197643-19197665 AATCTGAACATGCACAAAAGTGG - Intergenic
1145832937 17:27931973-27931995 AAACTCAACATGACCCAAACTGG - Intergenic
1146376553 17:32298515-32298537 AAGCTTAACATGGCCAAAAGAGG - Intronic
1146477034 17:33171359-33171381 AAACTCAACATGTCCACACTTGG + Intronic
1147037227 17:37690763-37690785 GAATTCAACGTGCCTAAAATAGG - Intronic
1150754206 17:67896260-67896282 AATTTAAACATGCCCAATATTGG - Intronic
1151520526 17:74626031-74626053 AAACTCACCATGTCTAATATAGG + Intergenic
1152682327 17:81675097-81675119 AAACTGAATTTGCACAAAATCGG + Intergenic
1153243701 18:3053556-3053578 AAAATTAACATGCCCAATATGGG + Intergenic
1155088779 18:22485479-22485501 CAAATCAGCATGCCCAAAAATGG - Intergenic
1156564356 18:38167663-38167685 AAACTCAACATCCCAAATGTAGG - Intergenic
1156957924 18:42991475-42991497 AATTTCAAGGTGCCCAAAATTGG - Intronic
1158071142 18:53471956-53471978 CGACTCAAAATGACCAAAATAGG - Intronic
1158167177 18:54553906-54553928 AAACTGAACATGCCCCAAAGGGG + Intergenic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1159587158 18:70291570-70291592 AAAGTCAAAAAGTCCAAAATTGG - Intronic
1165296395 19:34929630-34929652 TAGATCAACATTCCCAAAATGGG + Intronic
1166031207 19:40131028-40131050 AAAATCAACAAACCTAAAATTGG + Intergenic
925356581 2:3246224-3246246 AAACACAACATTTACAAAATGGG + Intronic
925754637 2:7121693-7121715 AAACTCCACATCCCCAAAACAGG + Intergenic
925875213 2:8305597-8305619 AAACTGCAAATGCCCATAATAGG - Intergenic
926043537 2:9693279-9693301 GAACTCACGAGGCCCAAAATAGG - Intergenic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
931581222 2:63777300-63777322 AAACTGAAGATGCCAACAATTGG + Intronic
931621174 2:64211196-64211218 AAACTTAACAAGTCCAAACTTGG + Intergenic
931623225 2:64231953-64231975 AAACTTAACAAGTCCAAACTTGG - Intergenic
931958451 2:67454516-67454538 TAACTCACCATGCTAAAAATTGG + Intergenic
932521546 2:72419792-72419814 AAACTCAAAAAACTCAAAATTGG - Intronic
932832337 2:75002886-75002908 TAAAACAACATGACCAAAATGGG + Intergenic
934065201 2:88333969-88333991 AAATTTAATATGGCCAAAATGGG - Intergenic
934475565 2:94591254-94591276 ACACTCAACATGTCCAGAAAGGG + Intronic
934848671 2:97681500-97681522 AAACACAACATGCCAAAACTTGG + Intergenic
935885716 2:107617179-107617201 AGACTCAAAATCCCCAAGATGGG - Intergenic
938453108 2:131441520-131441542 AAACTTAATATGTCCAAAATGGG - Intergenic
939023837 2:136988672-136988694 AAAATTTACATGCCCAAAATTGG - Intronic
940799288 2:158115576-158115598 AAGCTCAACATTCCCAAAGCTGG - Intronic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
943153300 2:184141244-184141266 AAACTCAACATGTGAAATATGGG + Intergenic
943336685 2:186623656-186623678 CAAATGAACATGGCCAAAATAGG + Intronic
944079213 2:195767106-195767128 GATATCAACATGCCAAAAATTGG - Intronic
945271010 2:207940040-207940062 AAACTCAACAGTTCCCAAATTGG - Intronic
945301119 2:208217340-208217362 TTACTCAACATGCCCCAAGTCGG - Intergenic
947344600 2:229177936-229177958 AAAATCAAAATGCCCCAAACTGG + Intronic
947378472 2:229521611-229521633 AAACTCTACATGGCTAAAAGGGG - Intronic
947780531 2:232756905-232756927 AAAATCAGCAAACCCAAAATAGG - Intronic
1169173365 20:3485541-3485563 AAACATATCATGGCCAAAATGGG - Intronic
1169456089 20:5753838-5753860 AACCTCATCTTGCCCCAAATGGG + Intronic
1169799164 20:9497450-9497472 TAACTAAACATGTCCACAATGGG - Intergenic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1170706127 20:18746106-18746128 AAACACAACACACCCAAAATAGG - Intronic
1170738389 20:19030569-19030591 AAACTCAACAAGCCCCAAATAGG - Intergenic
1174715480 20:52753359-52753381 AAACTCAACATCCAAAAAACAGG + Intergenic
1174750931 20:53110878-53110900 TGACTCAGTATGCCCAAAATGGG - Intronic
1176899178 21:14418903-14418925 AAACTCAAAAGTCCCCAAATGGG + Intergenic
1179295777 21:40061125-40061147 AAATTCAACATGACCCAAATAGG + Intronic
1182760645 22:32719951-32719973 AGACTCAAAGTGCCCAAATTGGG - Intronic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
949811998 3:8016160-8016182 AAACTCAACATGCTGACAAAAGG - Intergenic
952057853 3:29472148-29472170 AAACAGAACATGCCCAGCATAGG + Intronic
953846874 3:46434455-46434477 AAGCCCAACATGCCCAAAATTGG + Intergenic
954826486 3:53377874-53377896 AAAATCAACACGACCAAAACAGG + Intergenic
957552941 3:81730446-81730468 AAACTCACCAAGCCTAAAATTGG - Intronic
960352954 3:116615802-116615824 AAACCCAAAAAGCCCACAATGGG + Intronic
962027714 3:131566242-131566264 AAACTCTTCGTGACCAAAATGGG + Intronic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965594049 3:170389844-170389866 AAATGCAACAAACCCAAAATAGG - Intronic
965696532 3:171414188-171414210 AAACTCAAGATTCCCCAGATAGG + Intronic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
967017182 3:185492938-185492960 AAAGCCAATATGACCAAAATTGG + Intronic
967207907 3:187140015-187140037 AAAAACAACATGAACAAAATGGG + Intronic
967921820 3:194619629-194619651 AACCTCACCATGGCCAAATTAGG + Intronic
970712663 4:18881654-18881676 ATATTCAACATGCCAAAAACAGG + Intergenic
973793611 4:54401186-54401208 AACCACAAGATGCCCCAAATTGG + Intergenic
974151208 4:58011618-58011640 AAAATCAACATGCACAAATCAGG + Intergenic
976450774 4:85188411-85188433 AAACACAACATGCCAAATCTAGG - Intergenic
979073648 4:116242723-116242745 AAAATCATCATGCCCAACAATGG + Intergenic
980165458 4:129220890-129220912 AAGCTAAACATGTCCCAAATTGG + Intergenic
980381277 4:132021302-132021324 AAATTCAAAATGCCAAATATTGG + Intergenic
980476637 4:133326653-133326675 AAACTCAATATTACCAAAAATGG - Intergenic
981744774 4:148042088-148042110 AAACCCAACATGCCTACAACCGG + Intronic
982290662 4:153779065-153779087 AAACTTAAAATGCCCAAAGTGGG - Intergenic
985052547 4:186006867-186006889 AAAATCAACATACCAAAAATTGG - Intergenic
987483749 5:18495574-18495596 AAACTCAAAATAACCAAAATAGG + Intergenic
987518287 5:18944397-18944419 ACACACAACATGTCCACAATGGG - Intergenic
987580460 5:19784389-19784411 TGTCTCAACATGCCCAATATCGG - Intronic
989271432 5:39538073-39538095 AAACTTAACATGTCCCAAATTGG - Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
992810583 5:80383898-80383920 AAACTCAACATCTCCAAATATGG + Intergenic
994739363 5:103598793-103598815 AAATTAAACATGCCTAAAACTGG - Intergenic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
996148296 5:120002502-120002524 AAACTCAAAATGTTAAAAATGGG + Intergenic
996575422 5:124972626-124972648 AAACTCAACATGCCGGCAAAAGG + Intergenic
997197036 5:131987263-131987285 AAACCCAACATGCTCACACTCGG - Intronic
997953380 5:138259556-138259578 AAACTGAACATGCTCAAACCAGG - Exonic
998019256 5:138755744-138755766 AAACTCAAGGTGTCCAAAGTGGG + Intronic
999014007 5:148077117-148077139 AAACTCAATACACCCCAAATAGG + Intronic
999166488 5:149553448-149553470 AAACTCAAGATGCTTAAACTTGG - Intronic
999465554 5:151800808-151800830 AAACACAACAAAACCAAAATTGG - Exonic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1003447717 6:6200067-6200089 AAGCTCATCCTGCCCAGAATTGG - Intronic
1004403593 6:15311237-15311259 AGACTCACCATGCCCAAGACTGG - Intronic
1006321923 6:33324294-33324316 AACCTCAACTTTCCCAAAATTGG + Intronic
1006702766 6:35989578-35989600 AAACTCAGGATTCCAAAAATGGG + Intronic
1007016538 6:38473410-38473432 AAATTCCACATGCCTAAAATTGG + Intronic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1008620789 6:53269845-53269867 AAACTCAACATGCCACACACAGG + Intronic
1010682652 6:78814949-78814971 AAATTCAACATACACAAAATTGG + Intergenic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1013166931 6:107603174-107603196 GCACACAAAATGCCCAAAATTGG - Intronic
1015919255 6:138250286-138250308 TAACTCAACTTGCCTAACATAGG - Intronic
1016721095 6:147298927-147298949 AAAGTGAACAAACCCAAAATTGG + Intronic
1017416574 6:154227289-154227311 AAACTAATCATGCCATAAATTGG - Intronic
1018409557 6:163529905-163529927 GAACTCCACATGTCCAAACTGGG - Intronic
1018766239 6:166935277-166935299 AAACTCAATATATCAAAAATAGG - Intronic
1020217119 7:6201837-6201859 GAGCTCAAAATGCCCAAATTGGG + Intronic
1020870165 7:13619573-13619595 AAATTCAACATGACATAAATGGG - Intergenic
1024663168 7:51519373-51519395 AAAGCCACCATGCCCAAAAAGGG - Intergenic
1024823367 7:53360592-53360614 AAACTCAAAATGGCTAAAATTGG - Intergenic
1028210319 7:88066459-88066481 ACACTTAACATGTCCAAACTTGG - Intronic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1031302065 7:120072769-120072791 AAATGCAACATGCCAAAACTAGG + Intergenic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1032534626 7:132652479-132652501 AATCTCAACATGCCCCCAAAGGG - Intronic
1032870468 7:135979149-135979171 AAACTTAACATGTCCAGAATAGG + Intergenic
1033501678 7:141957393-141957415 AAACCCCACATACCCAAGATTGG + Intronic
1034220238 7:149438763-149438785 AAACTCATCAGGCTGAAAATGGG + Intronic
1038406054 8:27323854-27323876 AAACTCACCTTTCCCAGAATTGG + Intronic
1041415423 8:57602722-57602744 AAAATCAAACTGCACAAAATAGG + Intergenic
1042687506 8:71458767-71458789 AAACTCAACGTGTACAAAATTGG - Intronic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044288378 8:90437834-90437856 AAACTCAAGATCTCAAAAATTGG + Intergenic
1044410383 8:91875794-91875816 AAACTTAACTTGCCCTAAACTGG + Intergenic
1045825897 8:106397717-106397739 AAAGTCAACATGACCCAAGTAGG + Intronic
1045886701 8:107107061-107107083 AACCCCAACAGGGCCAAAATTGG - Intergenic
1045903593 8:107314969-107314991 AAACTCAACAGACACAACATGGG + Intronic
1046559670 8:115819754-115819776 AAACTCAACGTACCCCAAACAGG + Intergenic
1048754612 8:137724079-137724101 AAAATCAACAAAACCAAAATTGG + Intergenic
1050344066 9:4668874-4668896 AAATGAAACATGCCCCAAATGGG + Intergenic
1051262049 9:15273961-15273983 TAAATCAAGATGTCCAAAATGGG + Intronic
1051302899 9:15672361-15672383 AAAGTCAAAATGGACAAAATGGG - Intronic
1052854498 9:33398662-33398684 ACACTCAACATGCCCAGAAAGGG - Intronic
1053223087 9:36327583-36327605 AAACTCAACATATCCAAATATGG - Intergenic
1053682501 9:40494824-40494846 ACACTCAACATGTCCAGAAAGGG - Intergenic
1053932484 9:43123150-43123172 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG + Intergenic
1054295600 9:63330324-63330346 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054393621 9:64634828-64634850 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054428269 9:65140041-65140063 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054502110 9:65881502-65881524 ACACTCAACATGTCCAGAAAGGG + Intronic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1056009802 9:82315677-82315699 AAGCTCAATATGCCCAGGATTGG + Intergenic
1056882492 9:90410405-90410427 AAACACAAAATGCCAAAAATTGG + Intergenic
1057107023 9:92428818-92428840 AAACTGAACATTCCAAGAATGGG - Intronic
1059093630 9:111388888-111388910 AAACCCAACATGCCCAGAACAGG - Intronic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1060176658 9:121502218-121502240 AAACCTAACATGCCAACAATAGG + Intergenic
1061557276 9:131378683-131378705 ACACTCAAAATGCCCAGAACAGG - Intergenic
1061643521 9:131979671-131979693 AAACTCTCCATTCCTAAAATGGG - Intronic
1185947467 X:4393614-4393636 AAATGCTACATGCACAAAATGGG - Intergenic
1186486136 X:9935833-9935855 AAACTCCACAACCCCAAATTAGG - Intronic
1188438599 X:30191574-30191596 AAACTGAACATTACCAGAATTGG - Intergenic
1189172155 X:38919347-38919369 CAAATTAACATGCCTAAAATTGG - Intergenic
1189280028 X:39814522-39814544 AGACACAGCATGACCAAAATGGG + Intergenic
1192024822 X:67438461-67438483 AAACTCAACATATTCAAAATTGG + Intergenic
1193820501 X:86157984-86158006 AAACTCAAGATTCTTAAAATAGG - Intronic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1198453688 X:136793996-136794018 AAACTCAGTATGACCCAAATTGG + Intergenic
1200015753 X:153161758-153161780 AAGCTGAACATGCCTGAAATGGG + Intergenic