ID: 1183142346

View in Genome Browser
Species Human (GRCh38)
Location 22:35954604-35954626
Sequence CCTAATCATGTAAGCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183142346_1183142350 8 Left 1183142346 22:35954604-35954626 CCTCCATTGCTTACATGATTAGG 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1183142350 22:35954635-35954657 ATCCCAAGCCTTGCCCCACTTGG 0: 1
1: 0
2: 2
3: 52
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183142346 Original CRISPR CCTAATCATGTAAGCAATGG AGG (reversed) Intronic
908265826 1:62378227-62378249 CGTAAGTATGTAAGTAATGGAGG + Intergenic
918426437 1:184414913-184414935 CAAAATCATGAAAGCAAAGGTGG - Intronic
919052041 1:192523482-192523504 CATAATCATGTAAGGCATGTTGG - Intergenic
920840202 1:209547553-209547575 CCAAATCAGTTAAGGAATGGAGG - Intergenic
922316811 1:224449733-224449755 TTTTATCATGTAAGCAATGAGGG - Intronic
922587908 1:226749733-226749755 TATAATCTTCTAAGCAATGGAGG - Intergenic
924781818 1:247156818-247156840 CCTATCCATGTAAGCAATGTGGG - Exonic
1065427364 10:25619502-25619524 CCTGATGATGTAGGCACTGGAGG - Intergenic
1071695995 10:87871841-87871863 TCTATTCATGCCAGCAATGGTGG - Intronic
1074564006 10:114560090-114560112 CCAAATCTTGAAAGCATTGGTGG - Intronic
1075894446 10:125982998-125983020 CTTTATCCTTTAAGCAATGGAGG - Intronic
1081630869 11:44688701-44688723 CCTAATCTTGAAGGCATTGGGGG - Intergenic
1085140861 11:74140163-74140185 ATTAATCTTGTAAGGAATGGGGG - Intronic
1085345284 11:75764616-75764638 CCTCCTCATGTGTGCAATGGAGG + Intronic
1091200820 11:133779306-133779328 CCTGAGAATGTAATCAATGGAGG - Intergenic
1108822832 13:54374810-54374832 CCTGATCAAGCAACCAATGGTGG + Intergenic
1111499661 13:89100534-89100556 GCAAATCAGTTAAGCAATGGTGG - Intergenic
1113187689 13:107707999-107708021 CCTATTCATGCAAACAATTGGGG - Intronic
1114938365 14:27573503-27573525 CCCAATCATGTGAGCACTGGTGG - Intergenic
1115505543 14:34090415-34090437 CCTAATCATATTAGATATGGGGG + Intronic
1116032579 14:39590444-39590466 CCTAGACATGAAAACAATGGAGG + Intergenic
1117095851 14:52296559-52296581 CCTTATCATGTAAGAAATGGTGG + Intergenic
1117122185 14:52579963-52579985 GCTCATCATTTAAGGAATGGTGG + Intronic
1130679747 15:85986121-85986143 CCTGATCATCCAAGCCATGGAGG + Intergenic
1130843064 15:87719889-87719911 CTTAATGAGGTAAGAAATGGAGG + Intergenic
1138235441 16:55378304-55378326 CCTAAATATGAACGCAATGGTGG - Intergenic
1139681164 16:68564610-68564632 CCTATTCTTGTAAGGAATGTGGG + Exonic
1150318903 17:64193354-64193376 CCAAATCATTTAACCAATGATGG - Intronic
1157649952 18:49318145-49318167 CATGATGCTGTAAGCAATGGTGG - Intronic
1159760906 18:72424966-72424988 TCTAATCAGGTAAACAATTGTGG - Intergenic
1161177322 19:2852745-2852767 CCTACGAATGTAAGCAATGTGGG + Exonic
1162594579 19:11617756-11617778 CCTATGAATGTAAGCAATGTGGG + Exonic
1162598955 19:11652381-11652403 CCTATGAATGTAAGCAATGTGGG + Intergenic
1162607592 19:11722604-11722626 CCTATGCATGTAAGCAATGTGGG - Exonic
1162611381 19:11757014-11757036 CCTATAAATGTAAGCAATGTGGG - Intergenic
1162613966 19:11780660-11780682 CCTATGAATGTAAGCAATGTGGG + Exonic
1162616684 19:11807014-11807036 CCTATGAATGTAAGCAATGTGGG + Exonic
1162619784 19:11832884-11832906 CCTATGCATGTAAGGAATGTGGG + Exonic
1162624017 19:11868896-11868918 CCTAAGAATGTAAGCATTGTGGG + Exonic
1162629092 19:11912109-11912131 CCTATGAATGTAAGCAATGTGGG + Intronic
1162629140 19:11912692-11912714 CCTATGAATGTAAGCAATGCAGG + Intronic
1162633826 19:11950527-11950549 CCTATGAATGTAAGCAATGTGGG + Exonic
1162649622 19:12077629-12077651 CCTATGAATGTAAGCAATGTGGG + Exonic
1162653774 19:12112965-12112987 CCTATGAATGTAAGCAATGTGGG + Exonic
1162657891 19:12145489-12145511 CCTATGAATGTAAGCAATGTGGG - Exonic
1162672908 19:12273142-12273164 CCTATGAATGTAAGCAATGTGGG - Exonic
1162686642 19:12391453-12391475 CCTATGCATGTCAGCAATGTGGG - Exonic
1162686650 19:12391537-12391559 CCTATACATGTAAACAATGTGGG - Exonic
1162690982 19:12431143-12431165 CCTATGCATGTCAGCAATGTGGG - Exonic
1162690992 19:12431227-12431249 CCTATACATGTAAACAATGTGGG - Exonic
1162715394 19:12628257-12628279 CCTATGCATGTAAGGAATGTGGG + Exonic
1165556698 19:36639340-36639362 CCTATGAATGTAAGCAATGTGGG - Exonic
1165608366 19:37127488-37127510 CCTATGAATGTAAGCAATGCGGG + Exonic
1165608374 19:37127572-37127594 CCTATGCATGTAAGGAATGTGGG + Exonic
1166578835 19:43873551-43873573 CCTATGAATGTAAGCAATGCGGG - Exonic
926759399 2:16264288-16264310 CCTAATTTTGTCAGCATTGGGGG + Intergenic
929889476 2:45907144-45907166 CCTGATCATGTCAGCAATCCTGG - Intronic
932397274 2:71456582-71456604 TATAATCATGTAACCAAAGGAGG - Intronic
935548625 2:104427651-104427673 CCTAAGGAGGTTAGCAATGGAGG - Intergenic
938231857 2:129668541-129668563 CCTAAGCATGTAAGCCTAGGTGG + Intergenic
938804340 2:134792125-134792147 ACTAGTCATGAAAGCCATGGAGG - Intergenic
945374660 2:209065970-209065992 TTGAATGATGTAAGCAATGGTGG - Intergenic
1170823716 20:19775819-19775841 CATACTCAGCTAAGCAATGGAGG - Intergenic
1177590343 21:23156397-23156419 TCTAATCAGGTATGCAATAGTGG + Intergenic
1178467654 21:32862923-32862945 CCAAAACATTTAAGGAATGGAGG + Intergenic
1182448613 22:30404669-30404691 CCTCTCCATGTATGCAATGGAGG + Intronic
1183142346 22:35954604-35954626 CCTAATCATGTAAGCAATGGAGG - Intronic
965547909 3:169934269-169934291 CCTATTCAGATAAGCAATGATGG + Intronic
970382551 4:15522794-15522816 CCTAATCATGATAGCAAAGTAGG + Intronic
973986087 4:56355395-56355417 CCAAATCTTCTAAGCAATGTTGG + Exonic
976821722 4:89214341-89214363 CCTAAACATGGAAGGCATGGAGG - Intergenic
979362484 4:119781255-119781277 GCTCATCATGTAAGAAGTGGTGG - Intergenic
980982793 4:139668722-139668744 CCCCAGCCTGTAAGCAATGGCGG - Intronic
981183132 4:141769184-141769206 CCTAATAAAGAAAACAATGGGGG + Intergenic
989989665 5:50746457-50746479 ACATAACATGTAAGCAATGGAGG + Intronic
994800302 5:104365516-104365538 CCAAATCATGAAAAAAATGGTGG + Intergenic
995327733 5:110910526-110910548 CCTAATCATGGCAGTGATGGGGG - Intergenic
999218760 5:149958002-149958024 ACTAATGATGTATGCACTGGAGG - Intergenic
1003430917 6:6036589-6036611 CCTAATAATGAAAACAATGATGG - Intergenic
1007124123 6:39410574-39410596 TCTAAATATGAAAGCAATGGAGG + Intronic
1007413588 6:41679167-41679189 GCTGCTCATCTAAGCAATGGAGG - Intergenic
1009809909 6:68647921-68647943 TCTAATTATGTAAGCATTGTGGG - Intronic
1012452047 6:99362922-99362944 ACTTTTCATGTAAGCAAGGGGGG + Intergenic
1018581655 6:165313193-165313215 TCTAGGCACGTAAGCAATGGTGG + Intergenic
1020362818 7:7347906-7347928 CCTCCTCATGTAGGCAATGGGGG + Intergenic
1023775743 7:43605044-43605066 CATAATCATGTAAGAGATGGAGG - Intronic
1026372861 7:69719050-69719072 CCATTTCATGTAAGCAAAGGTGG - Intronic
1029923541 7:104291632-104291654 TCCACTAATGTAAGCAATGGGGG - Intergenic
1031728527 7:125267575-125267597 CTTAATGATGTAAGCACTGAAGG - Intergenic
1032493888 7:132346389-132346411 CCTACTCAAGTCAGTAATGGAGG + Intronic
1033583729 7:142759192-142759214 TCTAATGATGTAAGAAAAGGAGG - Intronic
1033585210 7:142769770-142769792 TCTAATAATGTAAGGAAAGGAGG - Intergenic
1048384016 8:133894361-133894383 CATAATCAAGTAGGCAATAGGGG - Intergenic
1052882471 9:33611927-33611949 TCTAATGATGTAAGGAAAGGAGG + Intergenic
1052900909 9:33794342-33794364 TCTAATGATGTAAGGAAAGGAGG - Intronic
1053511358 9:38690686-38690708 CTTTATCACGTAGGCAATGGAGG - Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1057663975 9:97028812-97028834 CATAAGGATGTAAGCAAGGGAGG + Intergenic
1059633646 9:116152512-116152534 TCAAAACATGTTAGCAATGGTGG - Intergenic
1060123647 9:121020514-121020536 CCTAAGCATTTAGGAAATGGGGG + Intronic
1060794845 9:126506619-126506641 CCTAAGGATGAAAGCAAAGGAGG + Exonic
1061739911 9:132694767-132694789 CAGAATCATGTAAGCAATTGAGG - Exonic
1196378548 X:115063942-115063964 CCTATGAATGTAAGCAATGTAGG - Intergenic
1197872273 X:131071461-131071483 CCTCATCATGGTAGCAATGATGG + Intronic
1202351736 Y:23999843-23999865 CCGAAACAAGCAAGCAATGGGGG + Intergenic
1202519043 Y:25670276-25670298 CCGAAACAAGCAAGCAATGGGGG - Intergenic