ID: 1183148263

View in Genome Browser
Species Human (GRCh38)
Location 22:36015834-36015856
Sequence GTGGACCACTGAACTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183148256_1183148263 11 Left 1183148256 22:36015800-36015822 CCCGAAATTATTACTTACCCTCC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 142
1183148259_1183148263 -6 Left 1183148259 22:36015817-36015839 CCCTCCCAAGAATTTTTGTGGAC 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 142
1183148257_1183148263 10 Left 1183148257 22:36015801-36015823 CCGAAATTATTACTTACCCTCCC 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 142
1183148260_1183148263 -7 Left 1183148260 22:36015818-36015840 CCTCCCAAGAATTTTTGTGGACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 142
1183148261_1183148263 -10 Left 1183148261 22:36015821-36015843 CCCAAGAATTTTTGTGGACCACT 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 142
1183148255_1183148263 18 Left 1183148255 22:36015793-36015815 CCTTTTACCCGAAATTATTACTT 0: 1
1: 0
2: 0
3: 20
4: 180
Right 1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 142
1183148254_1183148263 22 Left 1183148254 22:36015789-36015811 CCTGCCTTTTACCCGAAATTATT 0: 1
1: 0
2: 2
3: 6
4: 107
Right 1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183148263 Original CRISPR GTGGACCACTGAACTGAAGA AGG Intronic
903800907 1:25967503-25967525 GTGGATCTCTGAAGTGAAGATGG + Intronic
905693294 1:39957909-39957931 GGGGAACACTGAACTCCAGAAGG + Intronic
906490566 1:46265115-46265137 TTAGACTTCTGAACTGAAGAGGG - Intronic
921122120 1:212146367-212146389 CTGGACCACTGATCTAAACAGGG - Intergenic
921597661 1:217072394-217072416 ATATACCACTGACCTGAAGAGGG + Intronic
921661490 1:217808274-217808296 GGGGATCACTGAGCTAAAGAAGG - Intronic
922478211 1:225921476-225921498 GTGCATCACTGAACTGAGGTGGG - Intronic
923671115 1:236042188-236042210 GTGATCCTCGGAACTGAAGATGG - Exonic
1064112610 10:12551861-12551883 GGGGACCATTGGACTGAAGAAGG + Intronic
1064799745 10:19055836-19055858 GGGGACTACTGAAGGGAAGAGGG + Intronic
1071404079 10:85311819-85311841 GTGAACCACTGCTCTGAAAATGG - Intergenic
1071681115 10:87706712-87706734 TTGAACCACTGAACTGCAGTCGG + Intronic
1072957667 10:99901691-99901713 GTGGAACATGGAGCTGAAGAAGG - Intronic
1073585362 10:104704773-104704795 CTGGAACACTGAACATAAGATGG - Intronic
1078409669 11:11103822-11103844 GTGGAACACTGAGCTCAGGATGG + Intergenic
1078895138 11:15591268-15591290 GTGGACCACAGAACTGTCAATGG + Intergenic
1083635561 11:64118965-64118987 GTGGTGCATGGAACTGAAGAGGG - Exonic
1085147649 11:74216396-74216418 GTGGGCCAATGAAATTAAGATGG + Intronic
1089082468 11:115788283-115788305 GTGAACCACTGAACTTATCAGGG + Intergenic
1092593595 12:9975476-9975498 GTGGAACATTGAACTTGAGAGGG + Intronic
1093745881 12:22740729-22740751 GTGGAACACTGAACTGTTCACGG - Intergenic
1094383022 12:29864246-29864268 GTGCCCTAATGAACTGAAGATGG + Intergenic
1098200037 12:68044528-68044550 GGGGACCACTGAGTTAAAGAAGG + Intergenic
1100963639 12:99989603-99989625 GTGGATCACTGCGCAGAAGAAGG - Intergenic
1101529970 12:105564809-105564831 GAGGAGCACTGGAATGAAGAGGG - Intergenic
1103455169 12:121059744-121059766 GTAGGCCACAGAACTGCAGAAGG + Intergenic
1103690177 12:122766149-122766171 GTGTACCACAGAACAGAAGCGGG - Intronic
1104510538 12:129373724-129373746 ATGAACCACTGAACATAAGAAGG - Intronic
1106067500 13:26369500-26369522 GTGGTGCACTGAACTGAGGTTGG + Intronic
1107394351 13:39999789-39999811 ATGGACATCTCAACTGAAGAAGG + Intergenic
1107729095 13:43330325-43330347 GTGGACCACTGAGGTGGTGAAGG - Intronic
1109685205 13:65810864-65810886 GGGGACCACTGGAGTGGAGAAGG - Intergenic
1112389113 13:98966579-98966601 TTGGAACTCTGAAATGAAGAGGG + Intronic
1114202139 14:20531505-20531527 AAGGGCCAGTGAACTGAAGATGG - Intergenic
1116030089 14:39560966-39560988 TTGTGCCACTGAACTGAAGCTGG + Intergenic
1117803696 14:59468853-59468875 GTGGACCTTTGCAGTGAAGAAGG + Intronic
1118527562 14:66662560-66662582 GTGGTCATCTGAACAGAAGAGGG - Intronic
1120763986 14:88311735-88311757 GTGGATCTCAGAACTGAAAAAGG + Intronic
1128443526 15:67736804-67736826 GTGGACCGCAGAGCTTAAGAGGG - Intronic
1128925454 15:71651209-71651231 ATGGCCAACTGGACTGAAGATGG - Intronic
1130891514 15:88137585-88137607 GGGAACCTCTGAACCGAAGATGG + Intronic
1132329860 15:101004742-101004764 CTGGAGCCCTGAACTGCAGAAGG - Intronic
1133791426 16:9012489-9012511 GAGGACTTCTGACCTGAAGAAGG - Intergenic
1138820465 16:60253598-60253620 CTGGACCACTGAGCTTAAGGTGG + Intergenic
1142264335 16:89056863-89056885 GTGGCCCGCTTCACTGAAGACGG - Intergenic
1144033114 17:11340152-11340174 GAGCACCAATGAACTGAATATGG + Intronic
1145289814 17:21534283-21534305 ATGGACCACCGAACTGAACCTGG + Exonic
1146240717 17:31221282-31221304 ATTGACCACAGAACTGAAGTTGG - Intronic
1148319030 17:46733559-46733581 GGGAAGCACTGAACTGAGGAAGG - Intronic
1152267186 17:79302070-79302092 TTATACCACTGAACTAAAGATGG + Intronic
1152563316 17:81089394-81089416 GTGGACCACAGCACTGAGGCAGG - Intronic
1152942475 17:83180102-83180124 GGGCACCACTGAAATGAAGTGGG - Intergenic
1158407952 18:57177247-57177269 GAGGACCACTGAAAATAAGATGG - Intergenic
1158904285 18:61997114-61997136 GTGTTCCAGTGAACTGAACAGGG + Intergenic
1166273869 19:41737438-41737460 CTGGACCGCTGAGCTCAAGATGG + Intronic
1166722820 19:45007076-45007098 TTTGACCAAGGAACTGAAGATGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
926157128 2:10462475-10462497 GTGGCCCACTGACTTGAAGGTGG + Intergenic
926943090 2:18158596-18158618 TTGGAGCTGTGAACTGAAGAGGG + Intronic
931524341 2:63136013-63136035 GTGAGCCACTGCACTGAACAAGG + Intronic
931920535 2:67010189-67010211 GTGGTCAGCTGAACTGAACACGG + Intergenic
932276980 2:70458894-70458916 GTGAACCACTGAACAGAATGGGG + Intronic
940352236 2:152703073-152703095 CTGGACCTCTGAACTGATTAAGG - Intronic
942184122 2:173408129-173408151 GGTAACCACTGAACTGAAAAAGG - Intergenic
946055589 2:216898735-216898757 TTGGATCACTGAGCTTAAGATGG - Intergenic
946331699 2:219013246-219013268 GTGGACCACTGACCTGCCGTGGG + Exonic
947040177 2:225909826-225909848 GTGCACCCCTGATATGAAGACGG + Intergenic
947092606 2:226529347-226529369 GTGGAAAACAGAGCTGAAGATGG + Intergenic
947184995 2:227446680-227446702 GTGGACCACAGACCTGAATGTGG - Intergenic
1169744069 20:8925816-8925838 ATGGACCACTGAAGTGATGGTGG + Intronic
1170396782 20:15934335-15934357 CTGGAAGACGGAACTGAAGAAGG + Intronic
1171348976 20:24488391-24488413 GTGGAGCACTGAAGAGAAGTGGG - Intronic
1172711623 20:36929075-36929097 GTGAGCCACTTAACTGGAGAGGG + Intronic
1174079701 20:47962229-47962251 GGGGACCCCTGAAGTGAAGCAGG - Intergenic
1176677769 21:9795892-9795914 GCCAACCACTGAACTAAAGAAGG - Intergenic
1176859871 21:14004650-14004672 GTGGACCATAGAACTGAAATTGG - Intergenic
1178199118 21:30382446-30382468 ATGGACCACTTAACTGATGCAGG + Intronic
1182182286 22:28362796-28362818 GTGGAACTTTGAACTTAAGAGGG + Intronic
1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG + Intronic
1184138063 22:42561190-42561212 CTGGACCACTGCTCTGAAGCAGG - Intronic
1184290864 22:43497554-43497576 GTTCACCACTGAACTGACTAGGG + Intronic
949767205 3:7539729-7539751 GCAGACCACTGAAATGCAGAAGG + Intronic
950775263 3:15344229-15344251 GTGGTGCACAAAACTGAAGATGG + Intergenic
954941163 3:54374589-54374611 GAGGAACACTGAACGAAAGAAGG - Intronic
955446547 3:59017140-59017162 GAGCACAACTGAACTGAATAGGG + Intronic
961806192 3:129491049-129491071 GTGGACCTCTGAATTGTGGAGGG + Intronic
966394092 3:179483564-179483586 GTCCCCCACTGAATTGAAGAAGG - Intergenic
967187030 3:186952880-186952902 GTTGTCCACTGAAATGAGGATGG - Intronic
968749604 4:2381246-2381268 GTGGAACTCTGAACTTGAGAGGG + Intronic
970111195 4:12639809-12639831 TTGGACCACAGAACTGAATCAGG - Intergenic
971162497 4:24147561-24147583 TTGGCCAACTGAACTGAAAATGG + Intergenic
974465248 4:62247219-62247241 TGGAACTACTGAACTGAAGAGGG - Intergenic
975504838 4:75126229-75126251 GTGGCCCTCTGGACTTAAGATGG + Intergenic
975618882 4:76275841-76275863 GTGAACCACTGAAATGAAAAAGG - Intronic
978624077 4:110664788-110664810 ATGGATCACCAAACTGAAGAGGG - Intergenic
978628435 4:110714679-110714701 GTGGACTACTAAAGTGAGGAGGG + Intergenic
981314790 4:143331493-143331515 GTGGACCACAGAATTTAAGCTGG + Intergenic
984526967 4:180868705-180868727 GTGGACCATCGCATTGAAGAAGG - Intergenic
984648122 4:182241378-182241400 GGGCACCACTGAACAGAAGAAGG - Intronic
985397761 4:189562901-189562923 GCCAACCACTGAACTAAAGAAGG + Intergenic
995017843 5:107331890-107331912 GGTGACCACTCAACTGAAGGAGG + Intergenic
995654986 5:114415981-114416003 GTGAAGCACAGAACTGAACAAGG - Intronic
996268442 5:121572606-121572628 CTGTACCACTGAACTGGAAAAGG - Intergenic
1000741398 5:164974289-164974311 GTGGAACTTTGAACTCAAGAGGG + Intergenic
1001246587 5:170109479-170109501 ATGGACCAGTGAGCTGGAGATGG + Intronic
1002210950 5:177599125-177599147 GTGGAGCTGAGAACTGAAGAAGG - Intergenic
1003443087 6:6161278-6161300 GTGGGCCACTGGCCTGAAGTGGG - Intronic
1006913287 6:37578227-37578249 GTGGAGCACAGACCTGAAGGAGG + Intergenic
1007792907 6:44323301-44323323 GTGTACCACTGTACTCCAGATGG - Intronic
1008072649 6:47113261-47113283 GTAAACCACTAAACTGGAGAGGG + Intergenic
1010742390 6:79524290-79524312 GTGGACCAGTAAAATGATGATGG - Intronic
1011471633 6:87713775-87713797 TGGGACCACTGAACTCCAGAGGG - Intergenic
1013580654 6:111531011-111531033 GTGGGGCACTGAACAGAAGAGGG - Intergenic
1014562953 6:122913438-122913460 GTGGAACTCTGAACTTGAGAGGG + Intergenic
1016778269 6:147930085-147930107 GTGGATGGCTGAACTTAAGAGGG - Intergenic
1019385293 7:752122-752144 GCGGACCACTGACTTGATGAAGG + Intronic
1019610338 7:1933510-1933532 GTGGACCGCTGCTCTGGAGAGGG - Intronic
1028045006 7:86107265-86107287 GTGGAACTTTGAACTTAAGAGGG + Intergenic
1029207423 7:98878220-98878242 GTCCACCACTGGACTGAAGGTGG - Intronic
1029970734 7:104786170-104786192 TTGGACCACTGTGCTGATGAGGG - Intronic
1030924282 7:115431984-115432006 AGGGATCACTGAAATGAAGAAGG + Intergenic
1030950718 7:115788121-115788143 GGGGATGACTGAACTGAAGATGG + Intergenic
1031787571 7:126053279-126053301 TTGCAAAACTGAACTGAAGAAGG - Intergenic
1033848521 7:145464408-145464430 GGGGGCCACTGAACAGAAAAGGG + Intergenic
1035746319 8:1964093-1964115 GAGACCCACTGAACTGGAGATGG - Intergenic
1042081699 8:65060940-65060962 CTAGACCACTGAACTGATGATGG - Intergenic
1043660533 8:82735626-82735648 GTGGAACTTTGAACTGGAGAAGG + Intergenic
1046029631 8:108768122-108768144 GGGGAACACTTAAGTGAAGATGG - Intronic
1049750365 8:144280261-144280283 GTGGACCACAGAGCTGGGGATGG - Intronic
1050129405 9:2396004-2396026 TTGGACCACAGAACTGAGAAAGG + Intergenic
1050143232 9:2538506-2538528 GTGGATGACAGAACTGAAGATGG - Intergenic
1050494235 9:6223749-6223771 GGGGAACACAGAACTGAACAAGG + Intronic
1051208267 9:14713168-14713190 GTGGATCCCAGACCTGAAGAGGG + Intergenic
1052211528 9:25909933-25909955 GGTGAGCACTGAACTGAAGGTGG - Intergenic
1052480367 9:29017542-29017564 GTGCACCACTGTCATGAAGAGGG + Intergenic
1053384246 9:37674219-37674241 GTGGAACTCTGAACTTGAGAGGG - Intronic
1053447633 9:38165131-38165153 GTTGACCACAGAAATGAAGTGGG - Intergenic
1056031621 9:82559693-82559715 GAGAACCACTGAAAGGAAGAAGG - Intergenic
1056466264 9:86858568-86858590 GTGGACCACAAATCAGAAGATGG + Intergenic
1061648232 9:132024062-132024084 GTGGCCCAATGCACAGAAGATGG + Intronic
1061918342 9:133768865-133768887 GGGGACCACTGGAATGATGATGG - Intronic
1062166698 9:135111416-135111438 ATGGCCCATTGAACTGGAGAAGG + Intronic
1186899957 X:14043481-14043503 GAGGACTATTGACCTGAAGAAGG - Intergenic
1186977144 X:14919662-14919684 GTAAACGACTGAGCTGAAGAGGG - Exonic
1190685986 X:52873523-52873545 GAGGATCACTGGACTGCAGAAGG + Intergenic
1193625355 X:83813662-83813684 GAAGACGACTGAACTAAAGAAGG - Intergenic
1194144703 X:90247490-90247512 GTGCACCATTGCACTGAAGGTGG - Intergenic
1196398710 X:115291615-115291637 GTGTACCATAGAAATGAAGAGGG + Intronic
1196634653 X:117988470-117988492 GAGAACCACTGATCTAAAGAAGG + Intronic
1198143926 X:133835529-133835551 GTCTACCACTGACCTGGAGAGGG + Intronic
1200490458 Y:3816795-3816817 GTGCACCATTGCACTGAAGGTGG - Intergenic