ID: 1183150577

View in Genome Browser
Species Human (GRCh38)
Location 22:36034038-36034060
Sequence CTTGTCCAAGGTAAGATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183150577_1183150580 0 Left 1183150577 22:36034038-36034060 CCATATATCTTACCTTGGACAAG No data
Right 1183150580 22:36034061-36034083 ACCTTAGCATCTCTGAGGCCTGG No data
1183150577_1183150584 27 Left 1183150577 22:36034038-36034060 CCATATATCTTACCTTGGACAAG No data
Right 1183150584 22:36034088-36034110 TTCATTTATGTGACAGGCACTGG No data
1183150577_1183150583 21 Left 1183150577 22:36034038-36034060 CCATATATCTTACCTTGGACAAG No data
Right 1183150583 22:36034082-36034104 GGTTTCTTCATTTATGTGACAGG No data
1183150577_1183150579 -5 Left 1183150577 22:36034038-36034060 CCATATATCTTACCTTGGACAAG No data
Right 1183150579 22:36034056-36034078 ACAAGACCTTAGCATCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183150577 Original CRISPR CTTGTCCAAGGTAAGATATA TGG (reversed) Intergenic
No off target data available for this crispr