ID: 1183154559

View in Genome Browser
Species Human (GRCh38)
Location 22:36065371-36065393
Sequence TCCAGCTTGCGGGGAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183154551_1183154559 0 Left 1183154551 22:36065348-36065370 CCCTGACCCTCGCCTGCTTCTCT No data
Right 1183154559 22:36065371-36065393 TCCAGCTTGCGGGGAGCTTTTGG No data
1183154550_1183154559 4 Left 1183154550 22:36065344-36065366 CCTTCCCTGACCCTCGCCTGCTT No data
Right 1183154559 22:36065371-36065393 TCCAGCTTGCGGGGAGCTTTTGG No data
1183154553_1183154559 -6 Left 1183154553 22:36065354-36065376 CCCTCGCCTGCTTCTCTTCCAGC No data
Right 1183154559 22:36065371-36065393 TCCAGCTTGCGGGGAGCTTTTGG No data
1183154554_1183154559 -7 Left 1183154554 22:36065355-36065377 CCTCGCCTGCTTCTCTTCCAGCT No data
Right 1183154559 22:36065371-36065393 TCCAGCTTGCGGGGAGCTTTTGG No data
1183154552_1183154559 -1 Left 1183154552 22:36065349-36065371 CCTGACCCTCGCCTGCTTCTCTT No data
Right 1183154559 22:36065371-36065393 TCCAGCTTGCGGGGAGCTTTTGG No data
1183154549_1183154559 18 Left 1183154549 22:36065330-36065352 CCAAAACTCAAGCTCCTTCCCTG No data
Right 1183154559 22:36065371-36065393 TCCAGCTTGCGGGGAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183154559 Original CRISPR TCCAGCTTGCGGGGAGCTTT TGG Intergenic