ID: 1183156703

View in Genome Browser
Species Human (GRCh38)
Location 22:36081338-36081360
Sequence GGCCGCTGCCACAAAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183156703_1183156712 10 Left 1183156703 22:36081338-36081360 CCTGTCCCTTTGTGGCAGCGGCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1183156712 22:36081371-36081393 CTCTTCAGCACTCTGTCCCTGGG 0: 1
1: 0
2: 1
3: 21
4: 282
1183156703_1183156714 12 Left 1183156703 22:36081338-36081360 CCTGTCCCTTTGTGGCAGCGGCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1183156714 22:36081373-36081395 CTTCAGCACTCTGTCCCTGGGGG 0: 1
1: 0
2: 2
3: 22
4: 206
1183156703_1183156711 9 Left 1183156703 22:36081338-36081360 CCTGTCCCTTTGTGGCAGCGGCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1183156711 22:36081370-36081392 CCTCTTCAGCACTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 37
4: 310
1183156703_1183156713 11 Left 1183156703 22:36081338-36081360 CCTGTCCCTTTGTGGCAGCGGCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1183156713 22:36081372-36081394 TCTTCAGCACTCTGTCCCTGGGG 0: 1
1: 1
2: 2
3: 31
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183156703 Original CRISPR GGCCGCTGCCACAAAGGGAC AGG (reversed) Intergenic
900534004 1:3168135-3168157 GGGCGATGCCACAGAGGCACTGG - Intronic
900534024 1:3168193-3168215 GGGCGATGCCACAGAGGCACTGG - Intronic
900534064 1:3168309-3168331 GGGCGATGCCACAGAGGCACTGG - Intronic
901667217 1:10833067-10833089 GGAGGCTGCCCCAAAGGGCCAGG - Intergenic
903024501 1:20417848-20417870 GTCCTCTGCCATTAAGGGACTGG - Intergenic
905468738 1:38175838-38175860 GGCCAGGGCCACAAAGGAACTGG - Intergenic
907858659 1:58328496-58328518 GGCTGCTGCGGCAAAGGGCCTGG - Intronic
910801842 1:91154751-91154773 GGCCCCTGCCATAGAGCGACTGG + Intergenic
911960324 1:104293980-104294002 GGCCAGTGCTACAGAGGGACTGG + Intergenic
916511566 1:165476395-165476417 GGCCAGTGCCACAAAGTGCCTGG - Intergenic
917674329 1:177304955-177304977 GGCCTCTGCCACCTTGGGACTGG - Intergenic
1062815919 10:499947-499969 TGACCCTGCCACAATGGGACTGG + Intronic
1064418063 10:15168119-15168141 TGCGGCCGCCACAAAGGGAAGGG + Intronic
1065899328 10:30191032-30191054 TTCCGCTACCACAAAGGGAAAGG + Intergenic
1066332391 10:34438921-34438943 GGCTGGTGCCACAATGAGACAGG + Intronic
1072229682 10:93403750-93403772 ATCCACTGCCACAAAGGGAAGGG - Intronic
1076017771 10:127042226-127042248 GGCAGAAGCCACACAGGGACAGG - Intronic
1076595139 10:131620491-131620513 GGCAGCAGCCAGAAAGGGCCTGG + Intergenic
1082797323 11:57387654-57387676 AGCCTCTCCCACAAAGGGTCAGG + Intronic
1084183239 11:67456845-67456867 GGCAGCTGCCACCAGGGCACAGG - Intronic
1087453482 11:98353654-98353676 GGCTGATGCCACAAGGGGGCTGG + Intergenic
1089489393 11:118872417-118872439 GGCTGCTGACACAGTGGGACCGG - Intergenic
1091568003 12:1662252-1662274 GGCCGCGGCCACAGAGGGCTGGG - Intergenic
1096178626 12:49538940-49538962 GGCCGCCTCCTTAAAGGGACAGG - Intergenic
1096513854 12:52145877-52145899 GGGAGCTGACACAGAGGGACAGG - Intergenic
1099277211 12:80591793-80591815 GGCAGCAGGCACAAAGGCACAGG - Intronic
1102621767 12:114201841-114201863 GGCTGGTACCACAAAGGGGCTGG - Intergenic
1106017724 13:25884995-25885017 GGGCCCTGCCACAAAGTAACAGG - Intronic
1116872768 14:50083866-50083888 GGCCACGGCCACCAAGGGGCTGG + Exonic
1117519073 14:56532080-56532102 AGCAGCTGCCATAAAGGCACCGG - Intronic
1119780949 14:77276558-77276580 GGCCTCTGGCACACAGGGCCTGG + Exonic
1121625678 14:95384073-95384095 GGCCTCTGGGACAAGGGGACAGG + Intergenic
1122491108 14:102116764-102116786 GGGCGCTGCCACAATGGGGCTGG + Intronic
1125084194 15:35711530-35711552 GGCTGCTGTCATAAAGGAACAGG + Intergenic
1126287373 15:47028335-47028357 GGCACCTGCCACACCGGGACTGG - Intergenic
1126909310 15:53401378-53401400 GGCCTGTGCCACAAAGGATCTGG + Intergenic
1129206335 15:74039074-74039096 TGCTGCTGCCACCAAGGCACCGG - Intronic
1129287952 15:74541101-74541123 GGAAGCTGCTAGAAAGGGACCGG - Intergenic
1130292334 15:82613897-82613919 GGAGGCTGCCAGGAAGGGACTGG + Intronic
1132814339 16:1818641-1818663 GGCCGCAGCCATGAAGGGCCCGG + Intronic
1133738443 16:8633116-8633138 GGACGCTGACACAGAGGGCCTGG + Intronic
1136687497 16:32003802-32003824 GGCTGCAGCCACAAAGGGAGTGG - Intergenic
1136788110 16:32947353-32947375 GGCTGCAGCCACAAAGGGAGTGG - Intergenic
1136881673 16:33906436-33906458 GGCTGCAGCCACAAAGGGAGTGG + Intergenic
1139293460 16:65878626-65878648 GGCTGCTGGCAGAAAGGGACAGG + Intergenic
1139773984 16:69302066-69302088 CACTGCTGCCACAAAGGGCCAGG - Exonic
1140677241 16:77344608-77344630 GGTGGCTGCCACATAGGCACTGG - Intronic
1141932523 16:87215616-87215638 TGCTGCTGCCACACAGGGCCTGG - Intronic
1142278104 16:89133473-89133495 GGCCCCTGGCACTGAGGGACAGG - Intronic
1203090337 16_KI270728v1_random:1209010-1209032 GGCTGCAGCCACAAAGGGAGTGG - Intergenic
1143090516 17:4446878-4446900 GACCACTGCAACAAAGGGGCAGG - Exonic
1146009168 17:29180165-29180187 GGCCGCTGCTTCCAGGGGACGGG + Intronic
1146686801 17:34846584-34846606 AGCGGCTGCCCCAAAGGGACTGG - Intergenic
1147148477 17:38499471-38499493 GGCTGCAGCCACAAAGGGAGTGG - Intronic
1147200753 17:38799710-38799732 GGCCGCTGCCTCCCCGGGACGGG - Exonic
1151527577 17:74681450-74681472 GGACTCTGCCACAATTGGACAGG - Intronic
1152555524 17:81051184-81051206 GGCCTCTGTCCTAAAGGGACGGG - Intronic
1152744070 17:82031270-82031292 CGCCGCTGCCTTGAAGGGACGGG + Intergenic
1156275860 18:35581955-35581977 AGCGCCGGCCACAAAGGGACCGG - Intronic
1156987035 18:43360826-43360848 GGTGGCAGCCACAACGGGACAGG + Intergenic
1161190245 19:2950545-2950567 GGCCTCTGCCACGAAGATACGGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1165743378 19:38216680-38216702 GGCCACTGCCACAAAGTGGCGGG + Intronic
1165838382 19:38772834-38772856 GACCCCAGCCACAAAGGCACGGG + Intronic
1165841177 19:38789863-38789885 GACCCCAGCCACAAAGGCACGGG - Intronic
925371617 2:3349554-3349576 GGATGCTGCCAGACAGGGACAGG + Intronic
926425081 2:12732744-12732766 GGCGGCTGCTACCAAGGGCCTGG - Intronic
927213215 2:20651156-20651178 GGCCGCTGCCACCAGGGGGCAGG - Intergenic
940076362 2:149746598-149746620 GGTTGCTGCCACCGAGGGACTGG - Intergenic
943185162 2:184598306-184598328 CGCCGCTGCCGCAGAGGGCCGGG - Intergenic
947715800 2:232338316-232338338 GGGCGCTGGGACATAGGGACAGG - Intronic
947734824 2:232449062-232449084 GGGCGCTGGGACATAGGGACAGG - Intergenic
948109779 2:235445248-235445270 AGCAGCTGCCACTAAGGGAAAGG - Intergenic
948619948 2:239228021-239228043 GGACATTGCCACAAAGGGATGGG + Intronic
1169388443 20:5170336-5170358 GGCAGCTTCCACAGAGGGTCTGG - Intronic
1170702905 20:18719718-18719740 GACTGCTGTCACCAAGGGACAGG - Intronic
1170875591 20:20247060-20247082 TGCCCCTGCCACGAAGGGCCTGG + Intronic
1180824674 22:18854334-18854356 GGCCCCACCCACACAGGGACAGG + Intronic
1181125094 22:20697487-20697509 GGCCCCACCCACACAGGGACAGG + Intergenic
1181188056 22:21120213-21120235 GGCCCCACCCACACAGGGACAGG - Intergenic
1181211141 22:21290280-21290302 GGCCCCACCCACACAGGGACAGG + Intergenic
1181398362 22:22636608-22636630 GGCCCCACCCACACAGGGACAGG - Intergenic
1181501102 22:23315969-23315991 GGCCCCACCCACACAGGGACAGG - Exonic
1181651054 22:24259452-24259474 GGCCCCACCCACACAGGGACAGG + Intergenic
1181706328 22:24651287-24651309 GGCCCCACCCACACAGGGACAGG - Intergenic
1182692119 22:32171466-32171488 GGCCACTGGGACAAAGGGCCAGG - Intergenic
1183156703 22:36081338-36081360 GGCCGCTGCCACAAAGGGACAGG - Intergenic
1183352943 22:37343924-37343946 GGCCGCTGTCAAAGAGGGAGTGG + Intergenic
1183743298 22:39679888-39679910 TGCCCCTGCCACAAGGGGCCAGG - Intronic
1203215805 22_KI270731v1_random:5151-5173 GGCCCCACCCACACAGGGACAGG - Intergenic
1203274820 22_KI270734v1_random:80240-80262 GGCCCCACCCACACAGGGACAGG + Intergenic
949734991 3:7161333-7161355 GACCCATGCCACAAAGGGAAAGG - Intronic
951258688 3:20481690-20481712 AGCAGCTGCCACTGAGGGACTGG + Intergenic
952311540 3:32194920-32194942 GGCCACTGCCACAAAGCTTCTGG - Intergenic
954391684 3:50270975-50270997 GCCCACTTCCACAAAGGCACAGG - Exonic
954437599 3:50504126-50504148 GGCTGCTGGCAGAAAGGGCCTGG + Intronic
954437923 3:50505650-50505672 GGCTGCTGGCACCAAGGGAAAGG + Intergenic
960545028 3:118904348-118904370 GGTGGCTGCCACAATGGGAAAGG - Intronic
960702448 3:120451244-120451266 GGTCCCTGCCACAAAGGGGTAGG + Exonic
961548364 3:127651984-127652006 GGCTGCGGCCACAAAGGTACGGG + Intronic
967732410 3:192918118-192918140 TGCCGCTGCCAGAGAGGGCCAGG - Exonic
968749964 4:2383532-2383554 GTGCGCTGCCACTAAGGGAAAGG - Intronic
969371547 4:6734419-6734441 GGCCATGGCCACAAAGGGTCAGG + Intergenic
969485095 4:7467732-7467754 GGCCACTGCCACAAAATGAGGGG + Intronic
969723212 4:8904760-8904782 GGCCCCTCCCACATAGGGCCAGG + Intergenic
970025042 4:11614893-11614915 GGTTGCTGCAGCAAAGGGACAGG - Intergenic
972576179 4:40354072-40354094 GGCCGGTGCCACACTGGGCCAGG + Exonic
975363191 4:73496071-73496093 TGCTGTTGCCACAAAGGGAGCGG + Intronic
977946339 4:102918926-102918948 GGCAGCTGCCACATAGTGTCGGG - Intronic
980007444 4:127558804-127558826 GGTAGCTGCCACAATGGGGCTGG + Intergenic
995555986 5:113329237-113329259 GTCCTCTGCAACAAAGGGACAGG - Intronic
996330575 5:122324132-122324154 AGGCCCTTCCACAAAGGGACTGG + Intronic
997504319 5:134404680-134404702 GGCTGCTTCCACCAAGGGAGCGG + Intronic
998939085 5:147261102-147261124 TGAGGCTGCCACAAGGGGACGGG + Intronic
1010787470 6:80021181-80021203 AGCTGATGCCACAAAGGGAAGGG + Intronic
1012128571 6:95461960-95461982 GGCGGCTTCCAGCAAGGGACTGG + Intergenic
1013294120 6:108743525-108743547 GGTCGGTGGAACAAAGGGACTGG + Intergenic
1013485204 6:110590108-110590130 GGCCCCTGCCATGAAGAGACAGG + Intergenic
1014266217 6:119280965-119280987 GGCCGCTGCCAAACAGCAACTGG + Intronic
1016935297 6:149445357-149445379 GGCCGCTGCCACAGAGCCAGAGG - Intergenic
1017146772 6:151241252-151241274 GGCCGCTGCCGCAGGAGGACTGG - Intronic
1017502919 6:155042139-155042161 GGCAGCCGCCTGAAAGGGACCGG - Intronic
1021433589 7:20588917-20588939 GTCCGCTGCCCCAGAGGGTCTGG - Intergenic
1024064671 7:45722341-45722363 CGCCGCATGCACAAAGGGACAGG + Exonic
1024996695 7:55278046-55278068 GGACCCGGCCACAGAGGGACTGG - Intergenic
1025017551 7:55451180-55451202 GGCCCCTTCCACACAGGCACAGG + Intronic
1025093215 7:56079738-56079760 GGCGCCTGCCACAGAGGGATGGG - Exonic
1026544701 7:71311773-71311795 TGCCTCTCCCACACAGGGACTGG - Intronic
1030807800 7:113937766-113937788 AACAGCTGCCACTAAGGGACTGG - Intronic
1031968286 7:128044314-128044336 GGCCGCATCCACAAAGGGACAGG + Intronic
1033557303 7:142500053-142500075 GGCCCATGGCACAGAGGGACAGG - Intergenic
1034989492 7:155538997-155539019 GGCTGCTGCCACCAGGGGCCAGG + Intergenic
1037763202 8:21755943-21755965 GGACACTGCCTCTAAGGGACAGG + Intronic
1040948098 8:52906165-52906187 GGCCCCTGACACAAAGGAGCAGG + Intergenic
1047001819 8:120580823-120580845 GGCCACAGGCACATAGGGACAGG + Intronic
1047231589 8:123002296-123002318 GGCCCCTCCCACAAAGGGCCGGG + Intergenic
1048260453 8:132940645-132940667 GGCTGCTTGCACAAAGGGAAGGG + Intronic
1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG + Intergenic
1049664316 8:143836229-143836251 TGCCGCGGCCCCAAAGGGGCCGG + Intronic
1056142854 9:83700309-83700331 GGAAGCTTCCACAAAAGGACTGG + Intronic
1058732305 9:107862011-107862033 GGCAGCTGACTCCAAGGGACAGG + Intergenic
1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG + Intronic
1062001701 9:134219164-134219186 GGCCTCTCCGAGAAAGGGACAGG - Intergenic
1062220857 9:135414419-135414441 AGCCACTGCCTCATAGGGACGGG + Intergenic
1193524022 X:82566712-82566734 GGGGGCTGCCACAATGGGTCTGG - Intergenic
1195568355 X:106371500-106371522 AACAGCTGCCACCAAGGGACTGG + Intergenic
1201569092 Y:15395246-15395268 TGCGGCTGCCACCACGGGACAGG + Intergenic