ID: 1183160138

View in Genome Browser
Species Human (GRCh38)
Location 22:36107744-36107766
Sequence CCCAAACCTGCATGGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183160138_1183160144 -3 Left 1183160138 22:36107744-36107766 CCTCCAAACCATGCAGGTTTGGG No data
Right 1183160144 22:36107764-36107786 GGGATGAGACTGGGCGAGAGAGG No data
1183160138_1183160147 13 Left 1183160138 22:36107744-36107766 CCTCCAAACCATGCAGGTTTGGG No data
Right 1183160147 22:36107780-36107802 AGAGAGGAACGAGAGAGGGAAGG No data
1183160138_1183160146 9 Left 1183160138 22:36107744-36107766 CCTCCAAACCATGCAGGTTTGGG No data
Right 1183160146 22:36107776-36107798 GGCGAGAGAGGAACGAGAGAGGG No data
1183160138_1183160145 8 Left 1183160138 22:36107744-36107766 CCTCCAAACCATGCAGGTTTGGG No data
Right 1183160145 22:36107775-36107797 GGGCGAGAGAGGAACGAGAGAGG No data
1183160138_1183160148 19 Left 1183160138 22:36107744-36107766 CCTCCAAACCATGCAGGTTTGGG No data
Right 1183160148 22:36107786-36107808 GAACGAGAGAGGGAAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183160138 Original CRISPR CCCAAACCTGCATGGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr