ID: 1183160607

View in Genome Browser
Species Human (GRCh38)
Location 22:36110554-36110576
Sequence GACCCCAATCTGCCTCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183160607_1183160617 20 Left 1183160607 22:36110554-36110576 CCAGCGGGAGGCAGATTGGGGTC No data
Right 1183160617 22:36110597-36110619 GCAGCCTGTGGACCTTCTTTGGG No data
1183160607_1183160611 -6 Left 1183160607 22:36110554-36110576 CCAGCGGGAGGCAGATTGGGGTC No data
Right 1183160611 22:36110571-36110593 GGGGTCGGGGCCACGTGTGTTGG No data
1183160607_1183160616 19 Left 1183160607 22:36110554-36110576 CCAGCGGGAGGCAGATTGGGGTC No data
Right 1183160616 22:36110596-36110618 GGCAGCCTGTGGACCTTCTTTGG No data
1183160607_1183160612 -2 Left 1183160607 22:36110554-36110576 CCAGCGGGAGGCAGATTGGGGTC No data
Right 1183160612 22:36110575-36110597 TCGGGGCCACGTGTGTTGGCCGG No data
1183160607_1183160614 8 Left 1183160607 22:36110554-36110576 CCAGCGGGAGGCAGATTGGGGTC No data
Right 1183160614 22:36110585-36110607 GTGTGTTGGCCGGCAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183160607 Original CRISPR GACCCCAATCTGCCTCCCGC TGG (reversed) Intergenic
No off target data available for this crispr