ID: 1183170211

View in Genome Browser
Species Human (GRCh38)
Location 22:36182315-36182337
Sequence CTGTGGTGCTTTGTTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183170211_1183170214 12 Left 1183170211 22:36182315-36182337 CCTGCTGTAACAAAGCACCACAG No data
Right 1183170214 22:36182350-36182372 AAACCAACACGAAGTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183170211 Original CRISPR CTGTGGTGCTTTGTTACAGC AGG (reversed) Intergenic