ID: 1183172535

View in Genome Browser
Species Human (GRCh38)
Location 22:36198762-36198784
Sequence CAGGTCACACAGAGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183172528_1183172535 11 Left 1183172528 22:36198728-36198750 CCTAGTGGTGCAGGTGAGGAGGA 0: 1
1: 0
2: 1
3: 26
4: 297
Right 1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG 0: 1
1: 0
2: 6
3: 46
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183172535 Original CRISPR CAGGTCACACAGAGGGGACA TGG Intronic
900322539 1:2092263-2092285 CTCTTCACACAGAGGGGGCAGGG - Intronic
901220498 1:7580867-7580889 GAGGTCACACAGTCAGGACAGGG - Intronic
902512620 1:16974660-16974682 CAGGTCCCACAGAGAGGCCTGGG + Exonic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902889995 1:19435994-19436016 AAGGTCACACAGCTGGGACCCGG - Intronic
902998021 1:20242864-20242886 CAGGGATCCCAGAGGGGACAGGG + Intergenic
903018477 1:20377236-20377258 GAGGTCACACAGCTGGGACCTGG - Intergenic
903431448 1:23304265-23304287 CATGTCACATCGAGGGCACAAGG + Intronic
904434226 1:30483854-30483876 GAGGCCACACAGTGGGGACTGGG + Intergenic
904745950 1:32711239-32711261 AAAGTCACACAGAGAGGAAATGG + Intergenic
905107091 1:35570428-35570450 CAGGTATCCCAGAGGGCACATGG - Intergenic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
907242122 1:53086606-53086628 CAGGGCACACAGAAGGGCCCTGG - Intergenic
908207840 1:61869642-61869664 CAAGTCCCACAAAGGGGTCAGGG - Intronic
910241730 1:85093903-85093925 CAGGTCACCCAGATGGCATAAGG + Intronic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911016146 1:93334956-93334978 CAACACACACAGAGGGGAAATGG - Intergenic
912761215 1:112369271-112369293 CAGGTCACATAGTGGGGTGAGGG - Intergenic
913569745 1:120108778-120108800 CAGGTTACACAGAGAGCAGATGG - Intergenic
914239991 1:145846804-145846826 CAGATGACACAGCAGGGACATGG - Intronic
914290555 1:146269740-146269762 CAGGTTACACAGAGAGCAGATGG - Intergenic
914551599 1:148720523-148720545 CAGGTTACACAGAGAGCAGATGG - Intergenic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
915573114 1:156756510-156756532 CAGGTCACACAGTTGGCAAATGG - Intronic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
917121230 1:171646222-171646244 AAAGTCACACAGCTGGGACATGG - Intronic
917296308 1:173522947-173522969 AAGGTAACACAGAGCGGCCATGG - Intronic
918361164 1:183759422-183759444 CAGGCCAAACAGAGGAGATAAGG + Intronic
919517117 1:198539639-198539661 AAGGTCACACAGAGGGTAAATGG - Intronic
920541716 1:206783786-206783808 AAGGTCACACAGATGGGAAAGGG - Intergenic
920943818 1:210509687-210509709 CAGCACACACAGAGTGGAGAAGG - Intronic
921601491 1:217111129-217111151 CAGGTCAGACACTGGGGACCAGG + Intronic
921859352 1:220025486-220025508 AAAATCTCACAGAGGGGACAAGG + Intronic
922353941 1:224758730-224758752 CAGATCCTACACAGGGGACAAGG + Intergenic
922591966 1:226784219-226784241 CAGGGCACATAGAGGAGAGAAGG - Intergenic
922777524 1:228222840-228222862 AAGGTCACACAGTGGGTAAACGG + Intronic
922937776 1:229434467-229434489 CAGGGCGCTCAGAGTGGACATGG - Intergenic
924744360 1:246818418-246818440 CAGGTCCCACAGAGAGGCCTGGG - Intergenic
1062767978 10:80030-80052 CAGGTCACACCGGGTGGTCATGG + Intergenic
1063595966 10:7435952-7435974 CAGCTCCCACTGAGGAGACAGGG + Intergenic
1064252713 10:13719054-13719076 AAGGTCACACAGACGCCACATGG + Intronic
1066196729 10:33107111-33107133 CAGGTCCCACAAGGGGGTCAGGG + Intergenic
1066280944 10:33918058-33918080 CAAGTCCCACAAAGGGGTCAGGG - Intergenic
1066501546 10:36000030-36000052 CAGGTCACACAGATGTGACGTGG + Intergenic
1068990816 10:63148561-63148583 AAGGGCAAACAGAGGGGACCTGG + Intronic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070559084 10:77552323-77552345 GAGGTCACACAGCTGGGAAATGG - Intronic
1070830231 10:79413547-79413569 CAGGTCCCTCCAAGGGGACAGGG - Intronic
1070853008 10:79583069-79583091 CAGGTCACACAGCCGGGAAGTGG - Intergenic
1070888072 10:79922236-79922258 CAGGTCACACAGCCGGGAAGTGG + Intergenic
1072409331 10:95185102-95185124 TAGGTGACACAAAGGGGACCTGG + Intergenic
1073061591 10:100736714-100736736 CAGGTTTCCCAGTGGGGACAAGG - Intronic
1073997298 10:109330154-109330176 AAGCTCTCTCAGAGGGGACATGG - Intergenic
1074449726 10:113549361-113549383 GAGGTCACACAGTGGGGAGGTGG + Intergenic
1075159565 10:120011491-120011513 CAGGTGGCACAGGAGGGACAAGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075590690 10:123689003-123689025 CAGGTCACAAACAGGGGGAAGGG - Exonic
1076899168 10:133328687-133328709 GAGGTCACACAGAGTGCCCATGG + Intronic
1077131635 11:975878-975900 CAGCTCACACCAAGGGGACGGGG - Intronic
1077549469 11:3193643-3193665 CCCGACACTCAGAGGGGACAGGG + Intergenic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078189222 11:9077792-9077814 GAGATCCCACAGAGGGGAAATGG + Intronic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1078604807 11:12765712-12765734 CCTGTCACACACAGGGGAGAAGG + Intronic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1082904235 11:58288864-58288886 CAGTTCAAACAAAGGGGAAAGGG + Intergenic
1083632688 11:64103955-64103977 CAGGGCACAGAGAGGGGATCCGG - Exonic
1083839552 11:65296263-65296285 CAGGCCACATAGAGGTGACCTGG + Intronic
1084802613 11:71555021-71555043 CAGGGCACACATAGAGGAAATGG - Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085453841 11:76654908-76654930 TAGGGGACACAGAGAGGACAGGG - Intergenic
1085809409 11:79666998-79667020 TAGGTCCCCCAGAGGGGAGAAGG + Intergenic
1086063537 11:82723972-82723994 CAGCACACATAAAGGGGACAGGG + Intergenic
1087769039 11:102186998-102187020 TAGGTCAGACTGAGGGGACTCGG + Intronic
1088912506 11:114202453-114202475 CAGGTCACACAGAAGGCCCTGGG - Intronic
1089751138 11:120652025-120652047 AAGGTCACTCAGCGGGGAAATGG - Intronic
1094492888 12:30972238-30972260 CAGGTCACACCAAGGGCACAGGG + Intronic
1095483966 12:42665216-42665238 CAGTTCCCCAAGAGGGGACAAGG - Intergenic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1096780280 12:53987699-53987721 AAGGGCACAGAGAGGGTACAGGG - Intronic
1096845679 12:54405185-54405207 CAGGTCCCCCAGGGGGGTCAAGG + Exonic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1098387689 12:69935991-69936013 CAGGCCACACAGATGGGAGCAGG - Intronic
1099068264 12:78011890-78011912 CAGGTGAGAAAGAGAGGACATGG + Intronic
1099591650 12:84599127-84599149 AAGGTCACAGAGATGGTACATGG - Intergenic
1101449524 12:104763578-104763600 CAGGTCAGACATAGGGCACCTGG - Intergenic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101853936 12:108426653-108426675 CAGGTTACACAGCTGGGAAAAGG + Intergenic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1102956203 12:117060695-117060717 CAGCTCACCCAGTGGGGGCATGG + Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1103898517 12:124290875-124290897 CAGATCACACAGCCGGGACATGG + Intronic
1104085634 12:125471856-125471878 CAAGTCACACAAGGGGTACAGGG + Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104645845 12:130496745-130496767 CAGGCCACCCAGAGGAGCCAAGG + Intronic
1104993551 12:132640437-132640459 CAGGTCACACAAAAGCCACAAGG + Intronic
1105607416 13:21937938-21937960 CAGCTCCCACAGAGGGTTCACGG - Intergenic
1105870671 13:24503439-24503461 CAGGGAACAGGGAGGGGACAGGG + Intronic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1108498143 13:51044945-51044967 CAGGTGGCCCAGAGTGGACAGGG + Intergenic
1110071263 13:71182182-71182204 CAAGTCCCACACAGGGGTCAAGG - Intergenic
1110582978 13:77153416-77153438 CAAGTCCCACAAAGGGGTCAAGG + Intronic
1111643724 13:91003564-91003586 CAAGTCACACAGCTGGGAAAGGG - Intergenic
1111833680 13:93360898-93360920 CTGGCCACACAGTGGGGTCACGG - Intronic
1112135490 13:96574022-96574044 CATGTCACAAAGAGCAGACAGGG - Intronic
1113345530 13:109474201-109474223 AAGGTCAGGCAAAGGGGACAGGG + Intergenic
1113752044 13:112783333-112783355 CAGCCCACACAGAGAGGACTTGG + Intronic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1115136604 14:30116842-30116864 AAGAGCAAACAGAGGGGACAAGG + Intronic
1118327691 14:64792678-64792700 CAGGTCACACAGAGGAAAAATGG - Intronic
1119535274 14:75397793-75397815 CAGTTCAGACAGAGGGGACAAGG + Intergenic
1119665568 14:76482688-76482710 CAGGTCACAGAGAGTGGTCAGGG - Exonic
1121415344 14:93775417-93775439 CATGTCTCCCAGAGGGCACAGGG - Intronic
1121422065 14:93823394-93823416 CAGGTCACACAGCTGAGAAAGGG + Intergenic
1121908764 14:97770257-97770279 CAGGGCAGACAGAGCTGACAGGG - Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122942815 14:104990024-104990046 CACCACACACAGAGGGCACACGG - Intronic
1127274973 15:57434646-57434668 CAGGTCACACACAAAGGAAAGGG + Intronic
1127350310 15:58145176-58145198 AAGGGCACACAGAGGAGAAAAGG - Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130027939 15:80285991-80286013 GAGGACAGACAGAGGGGTCAGGG - Intergenic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1130774241 15:86961510-86961532 GAGGTTACACACAGGGGAGAGGG + Intronic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1132208406 15:100002487-100002509 CAGGACACACTGGGGGGACGAGG + Intronic
1132214229 15:100050820-100050842 CAGGGCACATAGAAGGGTCATGG - Intronic
1132353674 15:101156131-101156153 CAGGTGAGACAAAGGGGAGAAGG + Intergenic
1132784886 16:1651237-1651259 CAGGTTACACAGAGGTCACACGG + Intronic
1132784999 16:1652015-1652037 TAGGTCACACAGAGGTCACAGGG + Intronic
1132867763 16:2102380-2102402 CAGGAAACACAAAGCGGACATGG + Exonic
1132889764 16:2197689-2197711 GAGGTCAGACAGCAGGGACAGGG + Intergenic
1133549801 16:6843281-6843303 GATGTCACACAGAGTGGCCATGG + Intronic
1134023564 16:10938426-10938448 CATGTCACACAGTGGGGCCCAGG - Intronic
1134673986 16:16076479-16076501 AAGGTCACAGAGAGGGAGCACGG - Intronic
1134815004 16:17198481-17198503 GAAGACACAGAGAGGGGACAGGG - Intronic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1135249874 16:20891848-20891870 CCGTTCACAAGGAGGGGACAGGG - Intronic
1135990064 16:27213049-27213071 CAGGTCACCCAGCTGGGAGATGG + Intronic
1136036795 16:27546731-27546753 CAGATAACACAGAGGGGGCAAGG - Intronic
1136057287 16:27699742-27699764 CAGGGCACACAGTGAGGACCTGG - Intronic
1136075407 16:27813774-27813796 CAGGAAACACGGAGGGGACAAGG + Intronic
1137407577 16:48201998-48202020 AAGGTCACACAGTGGTGACCTGG - Intronic
1138113523 16:54342627-54342649 CAGGCCACCTAGAGGGGTCATGG + Intergenic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138458089 16:57132762-57132784 CAGGTCACACAGTGGGGCCTGGG - Intronic
1139332525 16:66204555-66204577 AAGGTGACACAGTAGGGACACGG + Intergenic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139611795 16:68064326-68064348 AGGGTCACACTGAGGGGAAATGG - Intronic
1141588169 16:85049075-85049097 GAGCTAAGACAGAGGGGACATGG - Intronic
1141900415 16:86987107-86987129 CACGGCACACACAGGAGACAGGG - Intergenic
1141915452 16:87093545-87093567 CAGCCAACACAGAAGGGACATGG + Intronic
1142219130 16:88844495-88844517 CAGGCCAGACAGAGGGGCCTCGG - Intronic
1142244681 16:88964556-88964578 CAGGTGATTCAGAGGGGACGAGG - Intronic
1142272605 16:89098369-89098391 CAGATCCCACAGAGGGGGCGTGG + Intronic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1143180542 17:4981610-4981632 CAGGGCTCCCAGAGGGGCCATGG - Intronic
1143303263 17:5926753-5926775 AAGGTCACACAGCCAGGACATGG + Intronic
1143707903 17:8712405-8712427 AAAGTCACACAGATGGGACCAGG - Intergenic
1144057910 17:11558401-11558423 CACTTCCTACAGAGGGGACAAGG - Exonic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1147048855 17:37775718-37775740 GAGGTCACACAGACGTGGCAGGG + Intergenic
1147513532 17:41094551-41094573 CAAGTCCCACAGAAGGGTCAGGG + Intronic
1147515623 17:41114846-41114868 CAAGTCCCACAAAGGGGTCAGGG + Intergenic
1149666436 17:58368041-58368063 CAGGTCACACTGAGGGGCAGTGG + Intronic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1150714056 17:67556544-67556566 CAGGGCACACTGATGGGCCAAGG + Intronic
1151304677 17:73255606-73255628 CAGGGCTCAGAGAGGGGAAAAGG + Intronic
1152137275 17:78511974-78511996 CAGGCCACCCTGAGGGCACAGGG - Intronic
1152209832 17:78997196-78997218 CCTGTCAGACAGTGGGGACAAGG - Exonic
1152219977 17:79058324-79058346 CAGGTCACACAAAAGCCACAAGG + Intergenic
1152260143 17:79262372-79262394 CAGATCCCACTGAGGGGACACGG + Intronic
1152297818 17:79478573-79478595 GGGGTCACACAGAGGAGCCAAGG - Intronic
1152419490 17:80184418-80184440 CAGGCTACACAGAGGGGCCTGGG - Intronic
1154075837 18:11200780-11200802 CAGGTCATAAAAAAGGGACACGG - Intergenic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1155107720 18:22684126-22684148 CTGATCCCACAGAAGGGACAAGG + Intergenic
1155109467 18:22699572-22699594 CAGGTCACTCAGACAGGAAATGG + Intergenic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1157166288 18:45361114-45361136 CAGGTCTCAGAGAGAGGAGAGGG - Intronic
1157290560 18:46406636-46406658 CAGGGCACACTGAGGGCACCCGG - Intronic
1158621926 18:59040448-59040470 CACTTCAAACAGAGGGGACGAGG - Intergenic
1159216608 18:65400029-65400051 CAGGTCACACTGAGGGGCTGAGG - Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1160993030 19:1868411-1868433 GAGGTCACACTGAGGTGACAGGG - Intergenic
1161108074 19:2454549-2454571 AAGGTCACACAGAGGGTAAGTGG + Intronic
1161156862 19:2736321-2736343 CATGTCATGCAGAGGTGACAGGG - Intronic
1162175019 19:8823975-8823997 CAGTTACCACAGAGGGGACAGGG - Intronic
1162262232 19:9542572-9542594 GGGGTCCCACAGATGGGACATGG - Intergenic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162745184 19:12793895-12793917 CAGGTCAGACGGAGGGGGCGTGG - Intronic
1162938678 19:13995165-13995187 CAGGCCACACAGCGGGGAAGTGG + Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163761312 19:19138114-19138136 GTGGTCCCACAGAGGGGACTGGG - Intronic
1164102136 19:22065711-22065733 CAGGACAAACACAGGTGACATGG + Intronic
1165452084 19:35889653-35889675 CAGGTCACACTGTGAGGTCAGGG + Intronic
1165484671 19:36088525-36088547 CAAGGCACACAGAGAGGACAGGG - Intronic
1165610428 19:37146744-37146766 CAGGTCACATAGAGGGGGAAAGG - Intronic
1165941976 19:39419160-39419182 AAGGTCACAAAGCAGGGACATGG - Intronic
1166139411 19:40798137-40798159 CAGGGCACACACAGGGTTCATGG - Intronic
1166533249 19:43554886-43554908 CAGGGCCCACACAGGGGACTGGG + Intronic
1166545724 19:43634076-43634098 CAGGTCACACAGATGGCAAGTGG - Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166881089 19:45930604-45930626 CAGGTCATTAAGAGGGGACGGGG - Intergenic
1167074239 19:47239489-47239511 CCGGCCACACCGAGGGGACCCGG - Intergenic
1167642207 19:50688077-50688099 CAGATCACACAGAGTAGACGAGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1168348606 19:55662801-55662823 CAGGTCACACAGAAAGCAAATGG - Intronic
927137869 2:20110569-20110591 CAAGCCACACAGAGAGGCCACGG - Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
927871495 2:26627164-26627186 CAGGTGCCACAGAGGGCCCAAGG - Intronic
928265501 2:29808180-29808202 CAAGTTACACAAAGAGGACATGG + Intronic
931463032 2:62464456-62464478 CGAGTCCCACAGAGGGGTCAGGG + Intergenic
931473528 2:62564555-62564577 CAGGTAACTCAAAGGAGACAGGG + Intergenic
932584994 2:73022147-73022169 CAGGTCACACACCGGTGAGAGGG + Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933348140 2:81116775-81116797 CAGGCAACACAGAGCTGACAAGG - Intergenic
933846136 2:86328714-86328736 CAAGTCCCACAGAGGGGTCAAGG - Intronic
936061697 2:109299026-109299048 CAGGTGACCCAGAGGGCACTGGG - Intronic
936553267 2:113469414-113469436 CAGGTCACAAACAAGGGGCACGG - Intronic
936868725 2:117108048-117108070 CAAGTCCCACAAAGGGGTCAGGG + Intergenic
936950335 2:117971650-117971672 GAGGTCACACAGCTGGGAAATGG + Intronic
937127127 2:119482051-119482073 CAGGCCACACAGCCAGGACATGG + Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938221738 2:129574980-129575002 CAGGCCACACAGAGACCACATGG + Intergenic
939798484 2:146678301-146678323 CAAGTCCCACAAAGGGGTCAGGG - Intergenic
940418837 2:153455341-153455363 CAAGTCCCACAGAGGGGTCAGGG - Intergenic
941731056 2:168918348-168918370 CTGGTCACACAGAGGACAAATGG + Intergenic
943066401 2:183091033-183091055 CAGGCTATACAGAGGGGACTAGG - Intronic
944067327 2:195633037-195633059 CTTTTCACACAGAGGGGAAATGG + Intronic
944199567 2:197091374-197091396 CAAGTCCCACAAAGGGGTCAGGG + Intronic
946100504 2:217316245-217316267 CAAGTCCCACCGAGGGGTCAAGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948588720 2:239036457-239036479 CAGGCACCACAGTGGGGACAGGG + Intergenic
948606724 2:239140706-239140728 CAGGTCAGAAGGAAGGGACATGG + Intronic
948613336 2:239183530-239183552 CAGGTGACACATAGGGCACGTGG - Intronic
948623125 2:239249220-239249242 CGGGGCAGACAGAGGAGACACGG + Intronic
948792910 2:240388474-240388496 CAGACCACCCAGCGGGGACATGG + Intergenic
948851082 2:240706275-240706297 GAGGTGACACAGAGGACACACGG + Intergenic
948913739 2:241019590-241019612 CAGCTCACACAGGCGGCACAGGG + Intronic
1168751291 20:283744-283766 CAGGTCACACAGCCAGGAAATGG - Intronic
1168789296 20:565438-565460 CAGGTCACACAGCCAGGAAATGG + Intergenic
1169447977 20:5688376-5688398 GAGGTCAGAGTGAGGGGACATGG - Intergenic
1169602355 20:7276103-7276125 CAGGTCACACAGCTGTGAGAAGG - Intergenic
1169892903 20:10472795-10472817 CAGGTAACAAAGAAGGGAAAAGG - Intronic
1170157219 20:13279762-13279784 CAGGGCAAACAGCGGGGACCAGG + Exonic
1170887596 20:20354983-20355005 GTGGTCACACTGAGGGGAGATGG + Intronic
1172153746 20:32809384-32809406 CAGGTCAGATGGATGGGACATGG + Intergenic
1173404400 20:42752412-42752434 AAGGTCACAGAGTTGGGACAAGG + Intronic
1173841023 20:46157414-46157436 AAGGTCACACAGTGAGAACAAGG + Intergenic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174797536 20:53534789-53534811 CAGATCACACAATGGGGATATGG - Intergenic
1174843831 20:53924096-53924118 CAGGTCAGCCTGAGGAGACAGGG - Intergenic
1175418693 20:58817771-58817793 CAGGCCACTGAGATGGGACAGGG - Intergenic
1175578347 20:60079475-60079497 GAGCTCACACGGAGGGGTCAGGG - Intergenic
1175733901 20:61372244-61372266 GAAGTCACACAGAGGTGACCTGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175893733 20:62326974-62326996 CAGGACAGACAGAGGTGACCTGG + Intronic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176222056 20:63974425-63974447 CAAAGCACACAGAGGGGACTAGG + Exonic
1176240193 20:64072381-64072403 CGGGTCAAACATGGGGGACAGGG - Intergenic
1176948065 21:15008271-15008293 AAGGTCACACAAAGGAGAGAAGG + Intronic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1177823744 21:26059957-26059979 CAGGTCACATAGAGAGTAAATGG + Intronic
1177836231 21:26188952-26188974 AAGCTAACACAGAGGGGAAAAGG + Intergenic
1178222474 21:30675492-30675514 CAAGTCCCACAGAGGTGTCAGGG + Intergenic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1179728424 21:43353834-43353856 CGGGTGTCACAGAGGGGACTTGG - Intergenic
1180067494 21:45419915-45419937 CGGGCCACAGAGCGGGGACACGG - Intronic
1180800838 22:18631128-18631150 CAGGGCACACTGAGGGGAACAGG + Intergenic
1180852071 22:19026685-19026707 CAGGGCACACTGAGGGGAACAGG + Intergenic
1181052023 22:20242377-20242399 CAGGGCACGCAGGGGGGCCAGGG + Exonic
1181220879 22:21364134-21364156 CAGGGCACACTGAGGGGAACAGG - Intergenic
1181863395 22:25836570-25836592 AAGGTCACCCAGAGGAGAGAAGG + Intronic
1182118268 22:27770475-27770497 AAAGTCACACAGCTGGGACAAGG - Intronic
1182146174 22:27998168-27998190 CAGGCCACACAGCCAGGACATGG + Intronic
1183014116 22:34971915-34971937 CAGGTCACACAGCTGGCTCATGG - Intergenic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183166099 22:36148491-36148513 CAGGTGACACAGAGAAGACGTGG + Intronic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183177129 22:36232594-36232616 CAGGTCACACAGAAGGGACTTGG + Intronic
1183180711 22:36257946-36257968 CAGGTCACACAGAGGGGATGTGG - Intronic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183356889 22:37364447-37364469 GAGGGCACTCAGAGGGGACAGGG + Intergenic
1183732293 22:39625437-39625459 CAGGTCACACAGCAGGCATATGG - Intronic
1183994247 22:41621030-41621052 GAGGTGACAGAGAGGGGACAGGG + Exonic
1184087009 22:42271075-42271097 CAGGTCACCGAGAGGAGACCGGG - Intronic
1184090480 22:42290545-42290567 CAGGCCACACTGTGGGGAGAGGG - Intronic
1184281742 22:43441345-43441367 CAGGTGACACAGTGGGCAGAGGG - Intronic
1184286558 22:43475087-43475109 TAGGTCACACAGAGGGTAAGGGG - Intronic
1185148589 22:49152027-49152049 ACGGGCACACAGCGGGGACACGG + Intergenic
950131361 3:10549096-10549118 CATGTCACACAGCTGGCACATGG - Intronic
950139043 3:10602394-10602416 CAGGCCACACAGTCAGGACATGG + Intronic
950956100 3:17054883-17054905 AAAGTCACACAGCAGGGACATGG - Intronic
951501386 3:23390789-23390811 CAAGTCCCACAAAGGGGTCAAGG + Intronic
953025065 3:39140240-39140262 CAGATCACAGAAAGGGGACTGGG - Intergenic
953917942 3:46932588-46932610 CTGGCCACACAAAGAGGACAAGG + Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955859342 3:63310944-63310966 CAGGACACACTGAGAGTACAGGG - Intronic
955957529 3:64305657-64305679 CAGGTCCCACAGTAGGAACAGGG - Intronic
956825830 3:72996550-72996572 AAGTTCACACAGAGAGGAAATGG + Intronic
959155778 3:102664432-102664454 CAGGTCCCACAAGGGGGTCAAGG + Intergenic
961366518 3:126403003-126403025 CAGGTGTCACTGAGGAGACAAGG - Intronic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
962851527 3:139311755-139311777 GAGGTCACACAGCTGGGAAATGG + Intronic
963206548 3:142642123-142642145 CAGGTTAGACAGAGGTGACAAGG - Intronic
964894166 3:161574793-161574815 CTGGTTACACAGAGAGGTCAAGG - Intergenic
965787650 3:172352876-172352898 CAGGACACAGAGAGTGGAGACGG - Exonic
967321819 3:188201944-188201966 CAGGTCAAGCAGAGGGGACAAGG + Intronic
967840196 3:193998990-193999012 AAGCTCACACAGAGGGAAGAGGG + Intergenic
968021374 3:195393340-195393362 GAGGTCACACAGAGGTGAAGTGG - Intronic
968273207 3:197420721-197420743 AAGGTCACATAGAGAGGTCAGGG + Intergenic
968563718 4:1298296-1298318 CAGGTCACAGGGATGGGGCAGGG - Intronic
969284579 4:6194907-6194929 CAGACCACACAGAGGGGAACAGG + Intronic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
971512226 4:27440955-27440977 CAGGTGACTCAGAGGACACATGG + Intergenic
973706696 4:53588429-53588451 CAGGTCACACAGGTAGCACATGG + Intronic
974064147 4:57062080-57062102 GAGGTCACACAGACTGGAAATGG + Intronic
974168456 4:58235044-58235066 CAGGTCAGTCAGAAGGGAGAAGG - Intergenic
977105411 4:92876758-92876780 CAGAACACACAGGGAGGACAGGG + Intronic
977890218 4:102301276-102301298 CAGGTCACACACAAGGGACCTGG - Intronic
980448141 4:132938442-132938464 CAGCTCCAACACAGGGGACAGGG - Intergenic
980603614 4:135059433-135059455 CGAGTCCCACAGAGGGGTCAGGG + Intergenic
982070381 4:151689064-151689086 CAGGTTACACACAGCAGACACGG - Intronic
982690663 4:158544373-158544395 CAGATCACCCAGAATGGACATGG + Intronic
984180686 4:176479124-176479146 CAGGTCCCACAGAGTGGGCTTGG + Intergenic
984397407 4:179219470-179219492 CAGGTCACACAGTGAATACAAGG - Intergenic
984760583 4:183359590-183359612 CAAGTCACCCAGACTGGACAGGG - Intergenic
985073930 4:186193985-186194007 CTGGTCTGACAGAGGGGACAGGG - Intronic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
988019366 5:25604146-25604168 CAGGTAAAACAAAGAGGACATGG + Intergenic
988166577 5:27597875-27597897 CAGGTCACACAGCCAGTACATGG + Intergenic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
993616933 5:90124496-90124518 CATGACACACACTGGGGACAGGG + Intergenic
994471403 5:100212563-100212585 CAGGCCACATAGAGAAGACATGG - Intergenic
995479822 5:112582802-112582824 CAGTTGTCACACAGGGGACAGGG - Intergenic
998032238 5:138880546-138880568 CATGCTACACAGAGGGGAAAGGG - Intronic
998445304 5:142193879-142193901 CAGGTCACAAAGTTGGGGCATGG + Intergenic
999284398 5:150385636-150385658 CAAGTCACAGAGTGGGGAGAGGG - Intronic
999624804 5:153509168-153509190 AATGTAACACAGAGGGGACTGGG + Intronic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002310965 5:178313535-178313557 AAGGTCACACAGTGGAGAAATGG + Intronic
1002791639 6:441571-441593 CAGGACCCACAGAGGGGTCTCGG + Intergenic
1002933970 6:1656022-1656044 CAGGTCACACAGAGAGTGCGTGG + Intronic
1003826699 6:9960767-9960789 CAGGTCACATAGAGGGCATCTGG + Intronic
1006782851 6:36643793-36643815 GAGGTCACACAGAGGGTAAAAGG - Intergenic
1007764512 6:44152773-44152795 CAGGCCACCCCGAGTGGACAGGG + Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1014486767 6:122008661-122008683 CAGGTGACAAAGTGGTGACATGG + Intergenic
1014812328 6:125901436-125901458 CAAGTCCCACAAAGGGGTCAAGG - Intronic
1015706597 6:136094511-136094533 AAGGCCACACTGAGGTGACATGG - Intronic
1015748890 6:136540198-136540220 CTGGTCACACGGAAGGGAAAAGG + Intronic
1016846313 6:148571570-148571592 CAGGTCAGACAGAAGCCACAAGG - Intergenic
1017968046 6:159284038-159284060 CAGGTCACACAATGGCCACAAGG + Intergenic
1018068178 6:160138163-160138185 AAGGTCACACAGCCAGGACATGG - Intronic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019183494 6:170207693-170207715 CAGGGCCCTCAGAGGGGACTCGG - Intergenic
1019298455 7:290984-291006 CAGGGCGCCCCGAGGGGACAAGG + Intergenic
1020136680 7:5591904-5591926 CTGGTCACACAGGAGGGACATGG - Intergenic
1021560104 7:21961090-21961112 CCGGTCACACACAGGGAAAAAGG + Intergenic
1021655876 7:22873251-22873273 AAAGTCACAGAGAGGGCACATGG + Intergenic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023856640 7:44188252-44188274 CATTTCACACAGAGGCGAGAGGG + Intronic
1026930442 7:74220445-74220467 CATGCCCCACTGAGGGGACAGGG + Intronic
1026991563 7:74588916-74588938 CAGGACACACTTAGGAGACAAGG - Intronic
1032216806 7:129963794-129963816 AAGGTCACACAGACGGTAAATGG + Intergenic
1033820110 7:145125088-145125110 AAGGTCACACAGAGGGGCATTGG + Intergenic
1034855212 7:154539184-154539206 CAGGGCCCACAGTGGGGAGAAGG - Intronic
1035302685 7:157907556-157907578 CACCTCACACACAGGAGACAGGG - Intronic
1035352949 7:158259262-158259284 CAGGCCACAGAGAAGGGCCATGG + Intronic
1035936651 8:3848684-3848706 CAGATCACACAGATGGTGCAAGG - Intronic
1036663298 8:10722197-10722219 CAGGACACACTGTGGGGGCATGG - Intergenic
1037196446 8:16196709-16196731 CAGGTCACAGTCCGGGGACAAGG + Intronic
1038992066 8:32878779-32878801 GAGGGCACCCAGAGGGGAGATGG - Intergenic
1039216317 8:35275665-35275687 CAGGTCACACAGAGAGTAAATGG - Intronic
1040661134 8:49577190-49577212 CAGGGCAAACAGAGGGGATTTGG + Intergenic
1041194534 8:55387628-55387650 CAGCTCACTCAGAGGGCAGAAGG - Intronic
1041267668 8:56081044-56081066 CAGGACAAAGAGAGGAGACAGGG - Intergenic
1042239080 8:66644755-66644777 AAGGTCACACATGGGGTACAAGG + Intronic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1044430296 8:92101194-92101216 CAGTTCACACAGAAGGTATAAGG + Intronic
1044784485 8:95780129-95780151 CATGCCAGACAGTGGGGACAGGG + Intergenic
1045331099 8:101156327-101156349 AAGGTCACACAGAAGGCACATGG - Intergenic
1045392096 8:101725759-101725781 CAAGTCCCACAGAGGGGTCAAGG + Intronic
1046514560 8:115241522-115241544 CAGGTCAGACAGAGGAAATAAGG + Intergenic
1047177604 8:122556231-122556253 AAGGTCACACAGAAGGGAAGTGG - Intergenic
1048043727 8:130754216-130754238 CAGGTCTGAGAGAGAGGACATGG + Intergenic
1048504448 8:135008148-135008170 CAGGTCACACAGTGGTGACTGGG + Intergenic
1048868756 8:138780316-138780338 CAGGTCTCAGAGAGGGAACCTGG - Intronic
1049075548 8:140393291-140393313 CAGGTCGCACAGTGAGGAAATGG + Intronic
1049151568 8:141038409-141038431 TATGTCACACAGCGGGTACACGG + Intergenic
1049427781 8:142545005-142545027 GAGGCCACACAGAGAGGAGATGG - Exonic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049899731 9:147750-147772 CAGGTCACAGACAAGGGGCACGG + Intronic
1050716198 9:8529138-8529160 CAAGTCACAAAAAGGGGAGAAGG + Intronic
1051366808 9:16327194-16327216 CAGGTCACACATGGGGAACTGGG - Intergenic
1053274231 9:36771155-36771177 AAGGTCACACAGGGGGCACATGG - Intergenic
1053417088 9:37953627-37953649 CAGGTCACACGGGGTGGCCATGG - Intronic
1053742781 9:41158038-41158060 CAGGTCACAAACAAGGGGCACGG + Intronic
1054348058 9:63987879-63987901 CAGGTCACAAACAAGGGGCACGG + Intergenic
1054445787 9:65314224-65314246 CAGGTCACAAACAAGGGGCACGG + Intergenic
1054484482 9:65707281-65707303 CAGGTCACAAACAAGGGGCACGG - Intronic
1054685560 9:68273260-68273282 CAGGTCACAAACAAGGGGCATGG - Intronic
1054818373 9:69497437-69497459 TGGGCCACACAGAGGGGACCTGG + Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1057299427 9:93869258-93869280 CACTTCGCACAGAGGGGACAAGG + Intergenic
1058766696 9:108188903-108188925 CAGGTCACATAGCTGGGACATGG - Intergenic
1059250898 9:112887167-112887189 CAGGGCACAGAGAGTGGAGACGG - Intronic
1059419031 9:114179579-114179601 CATGCCATCCAGAGGGGACAGGG - Intronic
1059458120 9:114412516-114412538 AAGGTCACACAGCAAGGACAGGG + Intronic
1060134319 9:121136958-121136980 TTGGCCACGCAGAGGGGACAGGG + Intronic
1060432413 9:123561774-123561796 GATGGCACACAGAGGGGAAAGGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1062186191 9:135219924-135219946 GAGGCCACACAGCGGGGAAATGG + Intergenic
1062599807 9:137314678-137314700 CTGGCCACACAAAGGGGACGGGG - Intronic
1062621287 9:137423528-137423550 CAGGTCCCCCAGAGAGGCCATGG - Exonic
1187704385 X:21994866-21994888 CAAGTCAGAAAGAGGGGACTGGG - Intergenic
1188266981 X:28088885-28088907 CAAGTGCCACAGATGGGACAGGG - Intergenic
1189294032 X:39906145-39906167 CACATGACTCAGAGGGGACATGG + Intergenic
1189384211 X:40524058-40524080 CAGTTCCCACATTGGGGACATGG + Intergenic
1190339513 X:49285946-49285968 CAGGCCACAGAGAGGGGAGGAGG - Exonic
1194352297 X:92835267-92835289 CAGGTGACACTGAGGAGTCAGGG - Intergenic
1196535869 X:116843507-116843529 GAAGTCACACAGATGGTACATGG + Intergenic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1198884113 X:141314970-141314992 CAGGTGTCACTGAGGGGACTTGG - Intergenic
1200128193 X:153828062-153828084 GAGGTTACTCAGGGGGGACAGGG + Intronic