ID: 1183172932

View in Genome Browser
Species Human (GRCh38)
Location 22:36201432-36201454
Sequence TCTGGGGCCCCCATGCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183172928_1183172932 14 Left 1183172928 22:36201395-36201417 CCTTTGTCTCAGGGTTCAGACAC 0: 2
1: 0
2: 2
3: 7
4: 180
Right 1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG 0: 1
1: 0
2: 0
3: 7
4: 136
1183172927_1183172932 18 Left 1183172927 22:36201391-36201413 CCTGCCTTTGTCTCAGGGTTCAG 0: 2
1: 1
2: 1
3: 14
4: 200
Right 1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG 0: 1
1: 0
2: 0
3: 7
4: 136
1183172923_1183172932 24 Left 1183172923 22:36201385-36201407 CCCTTTCCTGCCTTTGTCTCAGG 0: 2
1: 0
2: 4
3: 46
4: 443
Right 1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG 0: 1
1: 0
2: 0
3: 7
4: 136
1183172925_1183172932 23 Left 1183172925 22:36201386-36201408 CCTTTCCTGCCTTTGTCTCAGGG 0: 2
1: 0
2: 3
3: 56
4: 431
Right 1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183172932 Original CRISPR TCTGGGGCCCCCATGCAACA AGG Intronic
902720861 1:18303074-18303096 CCTGGGGCCCCCAACCACCAAGG + Intronic
903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG + Intergenic
907482445 1:54754523-54754545 TCCAGGGCCCCCAAGCTACAGGG + Intergenic
909404724 1:75275020-75275042 TCTGGGGTCCCCATGTACCCAGG + Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
919825488 1:201500380-201500402 TCAGGGGCCCACATCCAGCAGGG + Intronic
922075827 1:222243553-222243575 TCAGGGGCCTCCAGGCAAAAAGG + Intergenic
923992509 1:239454614-239454636 ACTGGGGCACCCTGGCAACAAGG + Intronic
1062901133 10:1147769-1147791 TCTGGGCCACCCATGCCAGAGGG + Intergenic
1062965958 10:1607997-1608019 TCTTGGCCCCCCATGGGACAGGG - Intronic
1067766575 10:49091686-49091708 TCGGGGTCCCCCATTCACCAAGG + Intronic
1068911189 10:62379947-62379969 TCTGGGGACCCTTTGAAACACGG + Intronic
1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG + Intronic
1073347006 10:102791132-102791154 TCTTGGGCCCACCTGAAACAGGG - Intronic
1075025507 10:118980449-118980471 TGTGGGGCCCCCATGGGAGACGG + Intergenic
1077062335 11:623364-623386 TCTGTGCCCTCCATGCACCACGG - Intronic
1078340303 11:10493704-10493726 TCTGGGGCAGCCATGGGACAGGG + Intronic
1078363966 11:10691752-10691774 TCACCGGCCCCCTTGCAACATGG - Intronic
1078700901 11:13681630-13681652 TCTGAGGTCCCCATGCTATAAGG + Intronic
1079123943 11:17705435-17705457 TCAGGGGCCACCCTACAACAGGG + Intergenic
1080641745 11:34162406-34162428 GCTGGGACCCCCCTGCTACACGG - Intronic
1084715833 11:70872828-70872850 TCTGGGGCCACAGTGGAACATGG + Intronic
1084785183 11:71437982-71438004 CCTGGGGCCCCCATGGACCTCGG + Intronic
1089132722 11:116224923-116224945 TCTGGGGCCCCCCCGCAGGAGGG + Intergenic
1089658914 11:119972992-119973014 TCTGGTGCACCCATGCACCCAGG + Intergenic
1092279703 12:7089994-7090016 TCTTGGCCCCCCATTCAATATGG + Intronic
1092996480 12:13955892-13955914 TCTGGTGCCACCATGCAGCTGGG - Intronic
1094031659 12:26018912-26018934 TCTGGTCCTCCCATGCATCATGG + Intronic
1094212679 12:27909096-27909118 TCTGGTGGCCACATGGAACAGGG + Intergenic
1099072336 12:78060945-78060967 TCTGGGGCCCTGATGGAGCAAGG - Intronic
1101128700 12:101666294-101666316 TCTTGGGTCCCCAGGGAACACGG - Intronic
1101430629 12:104623972-104623994 TCAGGAGCCCCCATTCATCATGG - Intronic
1102917375 12:116764452-116764474 ACTTGGGCCTCCATGCAGCATGG + Intronic
1102976373 12:117209772-117209794 TTTGGGGCCCCTTTGCCACAAGG + Exonic
1104889203 12:132132256-132132278 TCTGGGGCCAGCAGGCAAAAGGG - Intergenic
1104966561 12:132511112-132511134 TCCAGGGCCCCCAAGCTACAGGG + Intronic
1105704803 13:22962260-22962282 TCTGGGGCCCTCTTGCAGCCAGG - Intergenic
1105846579 13:24299030-24299052 TCTGGGGCCCCATTGGAATAGGG + Intronic
1105857766 13:24387418-24387440 TCTGGGGCCCTCTTGCAGCCAGG - Intergenic
1113738778 13:112696866-112696888 TCTGGGGCCCCCTTGGAATGGGG + Intronic
1115396494 14:32914897-32914919 TCTGGGGCCACCTGGCTACATGG + Intergenic
1123696526 15:22882802-22882824 CCTGGGGCACCCATGCCAGAGGG - Intronic
1123860301 15:24459047-24459069 TCTGGGGTCTCCATGCACAAGGG + Intergenic
1126740468 15:51771943-51771965 TCTGGGGCATCCTGGCAACAAGG - Intronic
1129028930 15:72604770-72604792 TCTGAGGCCCCCAGGAAAGAGGG + Intergenic
1132466058 16:77938-77960 TCTGGGGCCGCCAGGCGACCAGG + Intronic
1132668039 16:1090807-1090829 GCTGGGGCCCCACAGCAACAGGG + Intronic
1133212767 16:4272458-4272480 CTTGGGGCCCCCATGCTCCAAGG + Intronic
1136997943 16:35203574-35203596 CCAGGGGTCCCCATGCAACAGGG - Intergenic
1138089817 16:54164991-54165013 GCCTGGGCCACCATGCAACAAGG - Intergenic
1145218565 17:21070212-21070234 TCTGGGCCTCCTATGAAACAAGG + Intergenic
1145250168 17:21293168-21293190 TCTGGGTCCTCCATGCCCCATGG - Intronic
1146955538 17:36934747-36934769 AGTGGGGACCCCATGCCACACGG + Intergenic
1147456492 17:40541524-40541546 TATGGGGCCACCAGGCTACAGGG + Intergenic
1147961036 17:44167742-44167764 TCTGGAGCCCACATCCAGCATGG + Intergenic
1148000891 17:44386217-44386239 TCCAGTGCCCCCATGCCACATGG - Intronic
1148238200 17:45983274-45983296 TCTGGGGCCCTCAGGCAGGAGGG - Exonic
1151435735 17:74095951-74095973 TCTTAGTCCCCAATGCAACAGGG + Intergenic
1152640829 17:81448515-81448537 TCTGGGGCCCACAGGGAAGACGG - Intronic
1153061810 18:1002956-1002978 TCTGGGGCCACCTTGGAAGATGG + Intergenic
1154191478 18:12234364-12234386 TCTGGGGCCCAAATGCAAACTGG - Intergenic
1155234824 18:23808830-23808852 TGTGGGGGCCCCATGCGCCAAGG + Intronic
1157491302 18:48125661-48125683 TCTGGGTCCACCATCCACCAGGG + Intronic
1158735708 18:60076016-60076038 TCTTGGGCCTCCAGGCAACTTGG - Intergenic
1160612615 18:80100264-80100286 ACTGGGACCCCCATCCAAAATGG + Intergenic
1161009873 19:1954941-1954963 GCTGTGGCCCTCAGGCAACAGGG + Intronic
1164146950 19:22518169-22518191 TCTGGGACCCCCATCCTACCCGG - Intronic
1165380427 19:35475730-35475752 TCTGGGGCCCCTCTCCAATAGGG - Intergenic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
1168324096 19:55529557-55529579 TCTGAGGCCCTCATGGACCAAGG + Intergenic
925731782 2:6924291-6924313 CCTCGGGCCCCCCAGCAACACGG - Intronic
926698743 2:15788608-15788630 TCAGTGGCCCCCATGCCCCAAGG + Intergenic
926999904 2:18783713-18783735 TCTGTGGTTCCCCTGCAACAAGG + Intergenic
929158741 2:38811131-38811153 TCTGAAGCACCCATGGAACATGG - Intronic
937428357 2:121818004-121818026 GCTGGGGCTCCCATGTGACATGG + Intergenic
938288707 2:130138296-130138318 TGTGGGGCCCCCAGGGAGCAGGG + Intergenic
938467826 2:131534636-131534658 TGTGGGGCCCCCAGGGAGCAGGG - Intergenic
948787469 2:240359816-240359838 TGTGGGCCCCTGATGCAACAAGG + Intergenic
1169790953 20:9410214-9410236 TGTGGGGACCCCATGCAGAATGG - Intronic
1171135173 20:22688964-22688986 TCTCAGGCCCCCATGCAAGCAGG - Intergenic
1172606329 20:36216718-36216740 TCTAGGGCCCACATGCCACTGGG + Intronic
1172651757 20:36507985-36508007 CCTGGAGCCACCATGCAAGAAGG - Intronic
1172707051 20:36889518-36889540 TCTTGGGTCCCCAGGCCACAAGG - Intronic
1172801660 20:37580439-37580461 TCTGGGGCTCCCATGGACCCAGG + Intergenic
1173248096 20:41349938-41349960 TCTGTGGCCCCCATGGGTCAGGG + Intronic
1175773746 20:61640334-61640356 GCTGGGGCCCTCATGCACCCTGG - Intronic
1176142840 20:63552909-63552931 CCTGGGGCCTCCATGCACCAAGG + Intronic
1181044436 22:20207858-20207880 TGTGGGGCCTCCATGCCCCAGGG + Intergenic
1181560854 22:23698734-23698756 CCAGTGGTCCCCATGCAACAGGG - Intronic
1181916812 22:26288003-26288025 TCTGGGTCCCCCAGGGTACAAGG - Intronic
1182214130 22:28701743-28701765 TCAGGTGCCACCATGCAACCTGG + Intronic
1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG + Intronic
1183180342 22:36255547-36255569 TCTGGGGACTCCATGCAGCAAGG - Intronic
1183212290 22:36458357-36458379 ACTGGGGACCCCATGCAGCCTGG - Intergenic
1184093999 22:42306656-42306678 TCAGGAGCCCCCATGCCACTGGG + Intronic
1185076308 22:48684780-48684802 CCTGGGGTCACCATGAAACATGG - Intronic
950113285 3:10434333-10434355 CCTGAGGCCCTCCTGCAACAGGG + Intronic
952311490 3:32194529-32194551 TTAGGGACCCCCATGCACCAAGG - Intergenic
953563970 3:44015313-44015335 TCTGGGTCTCCGAGGCAACATGG - Intergenic
956684184 3:71809242-71809264 TGTGGGGCCACCATGTTACAAGG + Intergenic
957952136 3:87141111-87141133 TCTGGGGACCCCCTCCAACATGG - Intergenic
961306337 3:125960781-125960803 TCCAGGGCCCCCAAGCTACAGGG + Intergenic
961379527 3:126487966-126487988 TCTGGGTCTCCCCTGCCACATGG - Intronic
961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG + Intronic
962251275 3:133837634-133837656 TCAGGGGCCCTCATGCTGCAAGG + Intronic
963284424 3:143419290-143419312 TCTGTGCCCCCCCTGCAAAATGG - Intronic
966192758 3:177286395-177286417 TCTCTGTCCCCCATGCTACAGGG + Intergenic
968540367 4:1165256-1165278 TCTGGGGCCCCCACGCCACTAGG - Intergenic
969561106 4:7948918-7948940 TCTGTCTCTCCCATGCAACAGGG + Intergenic
978404121 4:108361891-108361913 TCTGGGACCCTCTTGCTACAAGG + Intergenic
981416508 4:144500085-144500107 TCTGGGCCACCAAAGCAACAAGG - Intergenic
983680106 4:170343627-170343649 TCTGGGACCCACATGAACCATGG - Intergenic
985668674 5:1195308-1195330 TCTGGGGCCCCAAGGCTGCAGGG + Intergenic
985789213 5:1916268-1916290 TGTGGGGCCACCAGGCAGCATGG + Intergenic
987647349 5:20690955-20690977 GCTTGGGCCTCCATACAACATGG - Intergenic
992620897 5:78591766-78591788 TCTGCAGCCCCCATGGCACAAGG - Intronic
993003790 5:82409515-82409537 TTTGGGGGCCACAAGCAACATGG - Intergenic
999559364 5:152783503-152783525 TCTGGTGACCTCTTGCAACATGG + Intergenic
1006385086 6:33726372-33726394 CCTGCTGCCCCCACGCAACATGG + Intronic
1008430644 6:51412898-51412920 GCTGGGACTCCCATGCAGCAAGG - Intergenic
1010209739 6:73353676-73353698 TCTGGGGCCCCCATTCCCAAAGG + Intronic
1020465610 7:8475258-8475280 TCTGGGGACACCAAGCAGCAGGG - Intronic
1021535360 7:21698076-21698098 TCAGGGGCCACCATGGCACAGGG - Exonic
1021994020 7:26162589-26162611 ACTGCCGCCCCCATGGAACATGG + Intronic
1022507601 7:30916361-30916383 TCTAGGGCCCCCACCCAGCAGGG + Intronic
1023977045 7:45038138-45038160 ACCATGGCCCCCATGCAACAGGG - Intronic
1026365392 7:69643560-69643582 TCTGGGGACTCCATAAAACAAGG - Intronic
1028972578 7:96875490-96875512 TCTGGAGCCACCATGGAACTGGG - Intergenic
1029799647 7:102933230-102933252 TCTGGAGCCCACACCCAACATGG + Intronic
1032391408 7:131557130-131557152 TGTGGGGCCCCCATCCCGCACGG + Intronic
1035578053 8:720773-720795 TCTAGAACACCCATGCAACATGG - Intronic
1036711911 8:11085228-11085250 TCTGCGGCCCCCATGCTAGGTGG + Intronic
1040110372 8:43564556-43564578 TGGGGTGCCCCCATGCACCATGG + Intergenic
1040793050 8:51256127-51256149 TCTGGGGACTCCATGAAAAAAGG + Intergenic
1041265460 8:56060048-56060070 TCTGCGTTCCCAATGCAACATGG + Intergenic
1043703520 8:83321466-83321488 CTTGGGGCTCCCATGCAAGATGG + Intergenic
1045418472 8:101990676-101990698 TGTGAGGCCTCCATGCCACATGG + Intronic
1048849919 8:138635026-138635048 CCTGGGGGCCCCATGAAACCTGG + Exonic
1048969228 8:139635020-139635042 TCAGGGGTCCTCATGCAGCAGGG - Intronic
1049568395 8:143355681-143355703 TCGGGGGCCCAGATGTAACAAGG - Intronic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1057880517 9:98789799-98789821 TCTGGGGCCCTTCTACAACAAGG - Intronic
1061751010 9:132776976-132776998 TCTGAGACCCCCATGGAACCAGG - Intronic
1062702876 9:137917264-137917286 GCTGGGGCCTCCTTGCCACAGGG - Exonic