ID: 1183173429

View in Genome Browser
Species Human (GRCh38)
Location 22:36204585-36204607
Sequence GAGAATAAGGAGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1111
Summary {0: 1, 1: 0, 2: 4, 3: 98, 4: 1008}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173422_1183173429 -1 Left 1183173422 22:36204563-36204585 CCTTCCCTCATAGAGCTATTGCG 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG 0: 1
1: 0
2: 4
3: 98
4: 1008
1183173423_1183173429 -5 Left 1183173423 22:36204567-36204589 CCCTCATAGAGCTATTGCGAGAA 0: 1
1: 0
2: 4
3: 19
4: 151
Right 1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG 0: 1
1: 0
2: 4
3: 98
4: 1008
1183173421_1183173429 27 Left 1183173421 22:36204535-36204557 CCGAGCTTATCTACAAAAGCTGA 0: 1
1: 1
2: 0
3: 11
4: 155
Right 1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG 0: 1
1: 0
2: 4
3: 98
4: 1008
1183173424_1183173429 -6 Left 1183173424 22:36204568-36204590 CCTCATAGAGCTATTGCGAGAAT 0: 1
1: 1
2: 15
3: 89
4: 586
Right 1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG 0: 1
1: 0
2: 4
3: 98
4: 1008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173429 Original CRISPR GAGAATAAGGAGATGGAGGG AGG Intronic
900638322 1:3676302-3676324 GAGAAACAGGAGATGGGGAGGGG + Intronic
900639787 1:3683103-3683125 GGGAATAATGAGGTGGTGGGCGG + Exonic
900708047 1:4092941-4092963 GAGAGAGAGGGGATGGAGGGAGG - Intergenic
900791519 1:4684002-4684024 GGGAGGAAGGAGATGGAGGAAGG + Intronic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901742423 1:11350948-11350970 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
901748227 1:11388791-11388813 GAGACTAAGGAGATGGCGATGGG - Intergenic
901751693 1:11413915-11413937 GAGAAGGGGGAGAAGGAGGGAGG - Intergenic
902605238 1:17565481-17565503 GGCAATGAGGAGTTGGAGGGGGG - Intronic
902618971 1:17639547-17639569 GAGAGAAGGGAGATGGAGGAAGG - Intronic
902944899 1:19828156-19828178 AAGAGTATGGAGATGGATGGTGG - Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904319973 1:29690247-29690269 GAGAATTAAGAGCTGGAGTGAGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904819738 1:33234241-33234263 GAGGAAATGGAGATAGAGGGAGG - Intergenic
905204885 1:36337751-36337773 GAGAAGGATGAGAGGGAGGGAGG + Intergenic
905227368 1:36488059-36488081 GAGAACAAAGACATGGAGGCTGG + Intergenic
905848999 1:41258900-41258922 GAGAATATGTAAAGGGAGGGAGG + Intergenic
905932963 1:41802549-41802571 AATAAAAAGGTGATGGAGGGTGG + Intronic
906303787 1:44703345-44703367 GTGAATGGGGAGAGGGAGGGAGG - Intronic
906672725 1:47668464-47668486 GAGAAGGAGGAGGTGGAGGGAGG + Intergenic
906852952 1:49271705-49271727 GAGAAGAAGGAGGGGTAGGGAGG - Intronic
907746148 1:57215708-57215730 GGAATAAAGGAGATGGAGGGAGG - Intronic
907866294 1:58402497-58402519 AAGAAACAAGAGATGGAGGGAGG + Intronic
908022778 1:59915542-59915564 GAGAATAAGGAAATAGAGACAGG + Intronic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908561344 1:65309683-65309705 GCGAAAAGGGAGATGGAAGGTGG - Exonic
908764176 1:67539494-67539516 GAGACGGAGGAGGTGGAGGGAGG + Intergenic
909096361 1:71293173-71293195 GAGAGAAAGAAGAGGGAGGGAGG - Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910977245 1:92919722-92919744 AAGAATAAAGAAATGGAGGGAGG + Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911629820 1:100170692-100170714 AAGAAGAAAGGGATGGAGGGAGG - Intronic
911720544 1:101186760-101186782 GAGAAAAAGAGGAGGGAGGGAGG - Intergenic
911854244 1:102856602-102856624 GAAAATAAAGAAAAGGAGGGGGG - Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
912499405 1:110112208-110112230 GAGACTAGGGAAAGGGAGGGAGG - Intergenic
912516279 1:110218474-110218496 GAGAAAAAGGAGATAACGGGTGG - Intronic
912653095 1:111458574-111458596 GAATAAAAGGAGATAGAGGGAGG + Intronic
912938415 1:114023888-114023910 GAGAGTAATGAGATAGAGTGGGG + Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
912991771 1:114494398-114494420 GAGGATAAGGAGTGGGAGGGAGG + Intronic
913100458 1:115559348-115559370 GAGAAGAAAGAGATGGAGATTGG - Intergenic
913250062 1:116905980-116906002 GAAAATAAGGAATTGGATGGAGG - Intergenic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
914862282 1:151396818-151396840 GAGAAGAGAGAGAGGGAGGGAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915154612 1:153864643-153864665 GAGATGAAAGAGAGGGAGGGAGG + Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915301751 1:154955686-154955708 GAAAAGAAGGGGGTGGAGGGAGG - Intronic
915530506 1:156500061-156500083 GAGAGGAGGGAGAGGGAGGGAGG + Intronic
915606430 1:156954763-156954785 GAGAAGAAAGAAAGGGAGGGAGG + Intronic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916463262 1:165048138-165048160 GAAAATAAGGGGCAGGAGGGAGG - Intergenic
916522794 1:165580277-165580299 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
916935639 1:169625371-169625393 GAGAATAGGGCCATGGAGGTGGG - Intronic
917119769 1:171635184-171635206 GAGCACCAGGAGATGGAGGTGGG + Intergenic
918076838 1:181177003-181177025 GTGAATATGGAGGTGGAGGTGGG + Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920304036 1:205007483-205007505 GAGAAAAAAGAAAGGGAGGGAGG + Intronic
920448692 1:206040449-206040471 GGGAATTAGGAGATCGAGAGGGG - Intronic
920717713 1:208356496-208356518 GGGAATAAGGAGAAGGTAGGTGG - Intergenic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
920776563 1:208943786-208943808 GAGAAAGAGGAGAAAGAGGGTGG + Intergenic
920887942 1:209951279-209951301 GAGAAGAAGGGAATGGAGAGGGG - Intronic
921370705 1:214419938-214419960 GAGGATAGAGGGATGGAGGGAGG - Intronic
921511656 1:216038490-216038512 TAGAATAAGAAAGTGGAGGGGGG - Intronic
922453298 1:225754021-225754043 GAGAAAAAGGGCATGGAGGAGGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922936293 1:229425710-229425732 GAGAAGAAAGAGGAGGAGGGGGG + Intergenic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063136693 10:3223316-3223338 GAGGATGAAGAGATGAAGGGTGG - Intergenic
1063156091 10:3380559-3380581 GAGAATGAGGAGCTGGAGAATGG - Intergenic
1063917880 10:10902959-10902981 GAAGATAAGGAGAAGAAGGGAGG + Intergenic
1064026623 10:11853712-11853734 GAAACGAAGGAGATGGAAGGAGG - Intronic
1064142355 10:12801111-12801133 GAGAAGGAGGAGATGGAGTTGGG + Intronic
1064165068 10:12978747-12978769 CAGAATAAGGAAATGGAAAGAGG + Intronic
1064303205 10:14141093-14141115 GAGAAGCAGGAGATGGAGAATGG + Intronic
1064329587 10:14381151-14381173 GAGAAAAAGGAAATACAGGGCGG - Intronic
1064416728 10:15156294-15156316 GAGAAGAATGAGAGTGAGGGGGG - Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064703974 10:18051172-18051194 GGGAGGAAGGGGATGGAGGGAGG + Intergenic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1065101087 10:22334340-22334362 GAAAATAAGGAAAAGGAGAGAGG - Intergenic
1065728754 10:28691662-28691684 GGGAAGAGGGAGAGGGAGGGAGG - Intergenic
1065862971 10:29886846-29886868 GAGAGGAAGGAGATGGGGGTAGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1067558167 10:47286648-47286670 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1067694693 10:48526325-48526347 GAGTTAAAGGAGAGGGAGGGAGG - Intronic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068110986 10:52680805-52680827 AAGAAAAAAAAGATGGAGGGTGG + Intergenic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1069813421 10:71178953-71178975 GAGAATGAGGGGCTGGAGTGGGG - Intergenic
1070116064 10:73529986-73530008 GTGAATAAGTAGCTAGAGGGAGG - Intronic
1070223513 10:74475809-74475831 GAGAAAAAGGAGGGAGAGGGAGG + Intronic
1070331132 10:75418100-75418122 AAGAAGAGGGAGATGGAGAGTGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070520714 10:77250648-77250670 GAAGGTAAGGAGATGGATGGAGG - Intronic
1070810945 10:79297910-79297932 GAAAACAAGGAGAGGGAGAGGGG + Intronic
1071779122 10:88823266-88823288 AAGAATAAGGTAAGGGAGGGTGG - Exonic
1072799641 10:98384156-98384178 CAGAATAAGGGGCTGGGGGGAGG + Intronic
1073178345 10:101569841-101569863 GAGAAGAAAGAGATGGGGAGAGG - Intergenic
1073412726 10:103355493-103355515 AAGAATCTGGAGATGGAGGGTGG + Intergenic
1073448535 10:103595559-103595581 GAGAAAAAAGGGAGGGAGGGAGG - Exonic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073576392 10:104629613-104629635 GAGATTAAGGAGATGGGGACAGG + Intergenic
1073718289 10:106135032-106135054 TAGGATAAGGAGATTGAAGGAGG + Intergenic
1074087022 10:110215873-110215895 GAAAAAAAAGAGAGGGAGGGAGG + Intronic
1074260100 10:111844638-111844660 GAGATTCAGGGGAAGGAGGGAGG - Intergenic
1074369191 10:112885748-112885770 GAGATTAAAGAGACTGAGGGGGG + Intergenic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074697182 10:116059984-116060006 AAGAACAAGGTGGTGGAGGGAGG + Intronic
1076398396 10:130158609-130158631 GAAAATAATGAGCTGGAGGATGG + Intronic
1076555279 10:131317521-131317543 GAGAATAGGGGCATGGAGGGTGG - Intergenic
1077392593 11:2306996-2307018 GAGAAGAAAGAGGGGGAGGGTGG + Intronic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078181568 11:9015997-9016019 GAGAATGAGGAGGTGGTGGGAGG - Intergenic
1078317280 11:10304427-10304449 GAGAATTGGGATTTGGAGGGGGG - Intergenic
1078741338 11:14069190-14069212 GAGAAAACTGAGATAGAGGGAGG - Intronic
1078841500 11:15079786-15079808 GGGAATAAAGAGAAGAAGGGAGG + Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079091792 11:17485858-17485880 GAAAATAATGGGGTGGAGGGAGG + Intergenic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079619426 11:22535157-22535179 GAGAAGAAGGAGCTGTAAGGAGG - Intergenic
1079703937 11:23589050-23589072 GAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1079964384 11:26963153-26963175 GAGAAAAAAGAGAGGAAGGGAGG + Intergenic
1080281953 11:30567516-30567538 GAGAATAAGAAACTGGAGGGAGG - Intronic
1081153351 11:39659369-39659391 TAGAATAGAGATATGGAGGGTGG + Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081418754 11:42847005-42847027 GAGAATAAATAGTTTGAGGGAGG + Intergenic
1081842112 11:46210020-46210042 GGGGATAAGGAGATTCAGGGAGG + Intergenic
1081850608 11:46272755-46272777 AAGAGCGAGGAGATGGAGGGTGG + Intergenic
1082058058 11:47836252-47836274 GAAAATAAAAAGAGGGAGGGAGG + Intronic
1082977528 11:59087733-59087755 GATACTCAGGAGATGGAGGTGGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083893079 11:65606639-65606661 GAGAATAAGGAGCTGGGGGGCGG + Intronic
1083947506 11:65932470-65932492 GAGTATAAAGGGATCGAGGGTGG - Intergenic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1084739924 11:71133129-71133151 GTGAATGAGTGGATGGAGGGAGG + Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085845621 11:80061316-80061338 GCGAATGTGGAGAGGGAGGGTGG + Intergenic
1085931520 11:81089061-81089083 GAGAAAATGAAGATGGAGTGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1086426472 11:86688723-86688745 GTGAACAAGGAGAGGGAGAGAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086922868 11:92606982-92607004 GAGAAGATGAAGATGCAGGGAGG - Intronic
1087703191 11:101460525-101460547 GAACATATGGACATGGAGGGTGG + Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088031953 11:105262075-105262097 GGGAAGAAAGAGCTGGAGGGAGG + Intergenic
1088850270 11:113698505-113698527 GACAATCAGGAGAGGGAGAGTGG + Intronic
1089058526 11:115607443-115607465 GAGAGGAAGGGGATGCAGGGAGG - Intergenic
1089072369 11:115710547-115710569 GTGAAATAGGAGATGGGGGGAGG + Intergenic
1089146342 11:116331988-116332010 GACAAGGAGGAGATGGAGAGAGG - Intergenic
1089292728 11:117448068-117448090 GACATGAAGAAGATGGAGGGAGG + Intronic
1089534514 11:119152474-119152496 GACACTAAGGAGGTGGAGTGGGG + Intronic
1089573558 11:119425280-119425302 GAGCACAAGGTGGTGGAGGGAGG + Intergenic
1090004005 11:122984355-122984377 AAGAAAAGAGAGATGGAGGGAGG + Intergenic
1090285260 11:125494901-125494923 GGGAAGAAGGAGATGGAATGGGG - Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090979962 11:131710994-131711016 GAGAATAAGGAGAGAGAAGAAGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1092173858 12:6390028-6390050 GAGAGAAAGAAGAGGGAGGGAGG + Intronic
1092308493 12:7325978-7326000 GAGAATAAGAACATGGTGGCAGG - Intronic
1092518253 12:9238518-9238540 GAGATGAAGGAAATTGAGGGAGG + Intergenic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093016546 12:14161149-14161171 GAGGGTCAGGAGAGGGAGGGGGG + Intergenic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093950925 12:25164411-25164433 GAGAAGAAGGGAATGGAGGGCGG - Intronic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1094487010 12:30933478-30933500 GAGAGGAAGGAGCTGGAAGGGGG - Intronic
1094540982 12:31363047-31363069 AAGACTGAGGAGATGGAGGGAGG + Intergenic
1094646419 12:32328873-32328895 TGGAAACAGGAGATGGAGGGTGG + Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1096267449 12:50135095-50135117 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097360096 12:58649990-58650012 GTGAATAAGCAAATGGAGTGGGG + Intronic
1098216392 12:68224691-68224713 GAGAAAGGGGAGAGGGAGGGAGG + Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1100113884 12:91279053-91279075 GAGAATATGTAGATGTAGTGGGG - Intergenic
1100875227 12:98954935-98954957 AGGAATAAAGAAATGGAGGGTGG - Intronic
1101252799 12:102951785-102951807 GAGAAGAAGGAGGGGGAAGGGGG - Intronic
1101635651 12:106539152-106539174 GACAATAAGGAGGTGGGAGGAGG + Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102202562 12:111067767-111067789 GAGAACAAGGGGACAGAGGGAGG + Intronic
1103018276 12:117513099-117513121 GAGGGAAACGAGATGGAGGGAGG - Intronic
1103200726 12:119085852-119085874 GAGAGAAAGAGGATGGAGGGTGG + Intronic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1103938357 12:124488612-124488634 GAGAAGACGGGGCTGGAGGGAGG + Intronic
1104648832 12:130516529-130516551 GAGAAAAAAGGGATGGAGGGAGG + Intronic
1104846153 12:131847975-131847997 GGGATTAAGGAGATGATGGGAGG - Intronic
1104876312 12:132037414-132037436 GAGAAAAACGGGATGGCGGGTGG + Intronic
1105715661 13:23061427-23061449 AGGAAGAAAGAGATGGAGGGGGG + Intergenic
1105892715 13:24693334-24693356 GGGAAGGAGGAGAGGGAGGGAGG - Intronic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1106356398 13:28987454-28987476 GAGAGGAAGGAGATGGGGGTTGG + Intronic
1106389963 13:29325507-29325529 GAGAAGGAGGAGGAGGAGGGAGG + Intronic
1106929467 13:34648251-34648273 GAGAAGAAGAAGATGGGGGAGGG + Intergenic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1108547054 13:51506150-51506172 GACAATAAGGAGGGTGAGGGTGG - Intergenic
1108738995 13:53315146-53315168 GAGACTCAGAAGAGGGAGGGTGG + Intergenic
1108773422 13:53733531-53733553 GAGAAAAGAGAGATGGAGGGAGG + Intergenic
1109226896 13:59707929-59707951 GAGAATAATGAAATGAAGTGGGG - Intronic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1109993571 13:70091298-70091320 GAGAAAAAAGAGTTGGAGGAAGG - Intronic
1110046287 13:70836260-70836282 AAGAAAAAAGAGATGGAGAGAGG - Intergenic
1110529188 13:76576597-76576619 GGGGAGAAGGAGATGAAGGGAGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110641703 13:77831943-77831965 GGAAAGAAGGAGATGGAGGAGGG - Intergenic
1111536859 13:89612629-89612651 GAAAATAAGGAGAAGGTAGGGGG - Intergenic
1111908944 13:94288421-94288443 GAGACTGGGGACATGGAGGGAGG - Intronic
1112211246 13:97379797-97379819 GACATTCTGGAGATGGAGGGTGG + Intronic
1112347329 13:98601226-98601248 GAGGAACAGGAGTTGGAGGGAGG - Intergenic
1112370844 13:98792076-98792098 GAGTATCTGGAGATGGAGGGTGG + Intergenic
1112872143 13:103985977-103985999 GAGAAGCAGGAGATGGTGAGAGG - Intergenic
1112884313 13:104149582-104149604 GAAAACAAAGAAATGGAGGGAGG + Intergenic
1112948662 13:104962464-104962486 CAGAATAAGAAGATGGACCGTGG - Intergenic
1113159616 13:107365024-107365046 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
1113340258 13:109416141-109416163 GAGGATCAGGAGACCGAGGGCGG + Intergenic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1113855833 13:113445025-113445047 GAGAAGAAGGAGCTGGAGCTGGG - Intronic
1114282930 14:21211363-21211385 AAGAAAAAGGTGGTGGAGGGGGG - Intronic
1114547818 14:23515110-23515132 GAGCAAAAGGAGGTGGAGAGAGG + Intergenic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1116290005 14:43022447-43022469 GAGAAGAAAGGGATGGAGGGAGG - Intergenic
1116295042 14:43096972-43096994 GTGAATAAGCAGATGCAGTGTGG + Intergenic
1116626571 14:47272439-47272461 GAGAAGAAGAAGATGGGAGGGGG + Intronic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117489389 14:56230884-56230906 GAAAATAAAGGGATGGAGGAAGG + Intronic
1117736139 14:58770710-58770732 GAGATGAAGGAGGTGGTGGGAGG - Intergenic
1117818235 14:59620306-59620328 GAGACTAAGTAGATTAAGGGCGG + Intronic
1117845423 14:59906567-59906589 GAGAGTAAGAATATGAAGGGAGG - Intergenic
1118171699 14:63395446-63395468 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1118306619 14:64660420-64660442 GAGAGTAAGGAGGTGGATGCAGG - Intergenic
1118459544 14:65976007-65976029 GGGAAGCAGGAGAAGGAGGGAGG + Intronic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119104298 14:71909603-71909625 GAGAGAAAGGAGAGAGAGGGGGG + Intergenic
1119213490 14:72850316-72850338 AAGAATAGGGAGTTGGTGGGAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119993647 14:79227849-79227871 GAGAAGAAAGAGAGGAAGGGAGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121098400 14:91233632-91233654 GAGTGTGAGGACATGGAGGGTGG - Exonic
1121153669 14:91663074-91663096 GAGGAGAAGGAGGTGGAGGAGGG - Intronic
1121681303 14:95794843-95794865 GAGAAGTAGGACATGGTGGGAGG + Intergenic
1121821495 14:96971763-96971785 GAGAAGGAGGAGAAGAAGGGAGG + Intergenic
1121843837 14:97156147-97156169 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
1122603164 14:102931053-102931075 GAGGGTGAGGAGCTGGAGGGAGG + Exonic
1122878650 14:104680130-104680152 GAGAGTCAGAAGACGGAGGGGGG - Intergenic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1122915957 14:104859101-104859123 TGGAAGATGGAGATGGAGGGTGG - Intergenic
1123472576 15:20566068-20566090 CACATTAAGGTGATGGAGGGTGG - Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1123645427 15:22434285-22434307 CACATTAAGGTGATGGAGGGTGG + Intergenic
1123666676 15:22613853-22613875 TCAAATAAGGTGATGGAGGGTGG + Intergenic
1123732881 15:23161059-23161081 CACATTAAGGTGATGGAGGGTGG - Intergenic
1123751014 15:23358436-23358458 CACATTAAGGTGATGGAGGGTGG - Intronic
1123787638 15:23688747-23688769 GAGAAGGAGGAGGTGGAGGAGGG - Intergenic
1124283387 15:28382354-28382376 CACATTAAGGTGATGGAGGGTGG - Intronic
1124299311 15:28529259-28529281 CACATTAAGGTGATGGAGGGTGG + Intronic
1124320518 15:28708426-28708448 TCAAATAAGGTGATGGAGGGTGG + Intronic
1124481977 15:30086923-30086945 TCAAATAAGGTGATGGAGGGTGG - Intronic
1124521614 15:30410280-30410302 TCAAATAAGGTGATGGAGGGTGG + Intronic
1124537047 15:30555939-30555961 TCAAATAAGGTGATGGAGGGTGG - Intronic
1124543522 15:30607995-30608017 TCAAATAAGGTGATGGAGGGTGG - Intronic
1124563478 15:30795445-30795467 CAAATTAAGGTGATGGAGGGTGG - Intergenic
1124755094 15:32399299-32399321 TCAAATAAGGTGATGGAGGGTGG + Intronic
1124761601 15:32451652-32451674 TCAAATAAGGTGATGGAGGGTGG + Intronic
1124777029 15:32597416-32597438 TCAAATAAGGTGATGGAGGGTGG - Intronic
1124957865 15:34371238-34371260 GAGGAGAAGGAGATGGGAGGGGG - Intergenic
1124957872 15:34371257-34371279 GAGGAGAAGGAGGTGGGGGGAGG - Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1126405713 15:48320618-48320640 GAGACTAAGAAGCTGGAGGCTGG - Intergenic
1126715863 15:51516792-51516814 GAGACTCAGAAGAGGGAGGGTGG - Intronic
1126794356 15:52247913-52247935 GAGAATGTGGAGTAGGAGGGAGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127234910 15:57038451-57038473 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1127301167 15:57655205-57655227 GTGGAAAAGGGGATGGAGGGTGG + Intronic
1127449525 15:59103274-59103296 GAGACTCAGAAGAGGGAGGGTGG - Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128332185 15:66763145-66763167 CAGAACTAGGAGATGGAAGGTGG + Intronic
1128496143 15:68199735-68199757 GAGACTAAGGATGGGGAGGGCGG - Intronic
1128537775 15:68503647-68503669 GAGAAAGAGGAGGTAGAGGGTGG - Intergenic
1128596805 15:68959498-68959520 GAGAAAAAGGTGATGGGGGTGGG + Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129174086 15:73827406-73827428 GAGATAAAGGAGATGGTGGGAGG - Intergenic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129376545 15:75137334-75137356 GAGAAAATGGAGATGGACGCAGG - Intergenic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129601575 15:77001863-77001885 GAGAGAAAGGAGATGGATGAGGG + Intronic
1129649966 15:77478166-77478188 GAGAATAGGGAGATGAGGTGGGG + Intronic
1129701905 15:77773064-77773086 GAGAATAGGCTCATGGAGGGAGG + Intronic
1130519626 15:84652446-84652468 GCGATTAAGGATATAGAGGGCGG - Intronic
1130607823 15:85333516-85333538 GAAAATAGGAAGATAGAGGGTGG - Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1130788848 15:87130234-87130256 GAGGAAAGGGAGATGGAGGGAGG - Intergenic
1130978022 15:88792176-88792198 GAGATGAAGGAGATGAGGGGAGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131223920 15:90608144-90608166 GTGAGTAAGGGGATGGAGAGAGG + Intronic
1131302269 15:91210113-91210135 GATAATTAGGAGATGGAGATAGG + Intronic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131831159 15:96355368-96355390 GAGAAGAAGGGGGTGGAGGGGGG + Intergenic
1131915697 15:97263532-97263554 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1132085258 15:98903317-98903339 AGGAAAAAGTAGATGGAGGGTGG + Intronic
1132433396 15:101778255-101778277 CAAATTAAGGTGATGGAGGGTGG + Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1134171916 16:11976106-11976128 GAGATTGAGGAGGTGGAGGGAGG - Intronic
1134298683 16:12969990-12970012 GAGAAAAATGAGATGGGGAGAGG + Intronic
1134569379 16:15278455-15278477 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1134689102 16:16179285-16179307 GGGAATAGGGAAATGGATGGTGG - Intronic
1134752053 16:16633044-16633066 TAGAATAGGGAGATGGGGAGAGG - Intergenic
1134934440 16:18234383-18234405 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135624879 16:23985775-23985797 GAAAATAAGGATAATGAGGGTGG + Intronic
1135660372 16:24291497-24291519 GAGAGCAAGAAGATGGAGGTGGG + Intronic
1135862171 16:26066551-26066573 GAGAATGAGTAGATGGAAAGAGG - Intronic
1135973014 16:27086008-27086030 GAGACTCAGAAGGTGGAGGGTGG + Intergenic
1136021175 16:27441074-27441096 GAGAAAAAAGAAAGGGAGGGAGG + Intronic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1136654646 16:31702684-31702706 GAGAATGAGGAGAGGCTGGGGGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137386460 16:48047351-48047373 GAGGAGAAGGAGGTGGAGGATGG + Intergenic
1137602889 16:49768602-49768624 GAGACTGAGGAGATGGAGAAAGG - Intronic
1137633199 16:49962555-49962577 AGGAAGAAGGAGATGAAGGGTGG + Intergenic
1137684250 16:50374780-50374802 GAGACTGAGGAGGGGGAGGGAGG + Intergenic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1137950580 16:52779795-52779817 GGGAAAGAGGAGATGAAGGGAGG + Intergenic
1138270286 16:55691168-55691190 GAGAGCAAGAAGAGGGAGGGAGG + Intronic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1139933966 16:70553876-70553898 GATAACCAGGAAATGGAGGGTGG - Intronic
1140153783 16:72401174-72401196 GAGGAGAGGGAGAGGGAGGGGGG + Intergenic
1140357602 16:74319581-74319603 GAGAAGAAGGAGAAGAAAGGAGG - Intergenic
1140724446 16:77799368-77799390 GAGAAAGAGGAGAGAGAGGGAGG - Intronic
1140798616 16:78464261-78464283 GATGACAGGGAGATGGAGGGAGG + Intronic
1140855713 16:78975932-78975954 GGGTATCAGGGGATGGAGGGTGG - Intronic
1140951455 16:79822389-79822411 GAGAATGATGGGGTGGAGGGAGG + Intergenic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141543133 16:84742376-84742398 GAGAATGAAAACATGGAGGGAGG - Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141782443 16:86172496-86172518 GAGAAGAAAGAAATGGAGGGAGG - Intergenic
1142478624 17:204589-204611 GTGAGTGAGGAGATGGATGGAGG - Intergenic
1142567407 17:849622-849644 GAGGACAAGGACGTGGAGGGAGG - Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1142928323 17:3260302-3260324 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
1143087570 17:4427568-4427590 GAGAAAATTGAGATGGAGAGAGG + Intergenic
1143198061 17:5091763-5091785 GAGAATAATGAGAGTGAGAGAGG + Exonic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143666792 17:8367018-8367040 GAAAATAAGTAGATGAAGGAAGG - Intergenic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1143823187 17:9581536-9581558 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1143947431 17:10605475-10605497 GAGAAGGAGGAGGGGGAGGGAGG + Intergenic
1144283010 17:13745465-13745487 GAAGAGCAGGAGATGGAGGGAGG - Intergenic
1144378433 17:14668705-14668727 GAGATTAAGGAGAAAGTGGGTGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1146132925 17:30293975-30293997 CGGAATAAGAAGATGGAAGGTGG + Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146527855 17:33582040-33582062 GAGAATAAGGGTCTGGAGGCAGG - Intronic
1146832437 17:36081644-36081666 GAGAAGCAGGACTTGGAGGGTGG - Intergenic
1146846919 17:36187962-36187984 GAGAAGCAGGACTTGGAGGGTGG - Intronic
1147032032 17:37646297-37646319 GAGAATTATGAGATGGGGGTGGG + Intergenic
1147303926 17:39550305-39550327 GAGAATAGCGAGGTGGAGGAAGG + Intronic
1147317802 17:39629151-39629173 GGATCTAAGGAGATGGAGGGAGG - Exonic
1147537864 17:41332647-41332669 GAGAAGAGGGAGGTGGAGGAAGG + Intergenic
1147970263 17:44215643-44215665 GAGAAGAAGAAGGTGGGGGGAGG - Exonic
1148495218 17:48049352-48049374 GAAAAAAAGGAGAGGGATGGTGG - Intronic
1148508831 17:48150658-48150680 GTGAACAAGGAGATAGATGGTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148996957 17:51719023-51719045 GGGAATAAAGAGCTGGAGTGAGG - Intronic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1149576353 17:57716215-57716237 GGGGATAAGGAGCTGGAGGATGG - Intergenic
1149663734 17:58351675-58351697 GAGAGGAAGGAGTGGGAGGGTGG - Intronic
1150006877 17:61475469-61475491 GAGAGAAAGTAGATGGAGGTAGG + Intronic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150245059 17:63668529-63668551 GAGATTGAGGGGATGGAGGTGGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150822214 17:68444862-68444884 GAGAAGGAAGAGAGGGAGGGAGG - Intronic
1150931813 17:69592962-69592984 GAGAAGAAAAAAATGGAGGGAGG - Intergenic
1151050999 17:70978550-70978572 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151051009 17:70978576-70978598 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1152315267 17:79576804-79576826 GAGAAGATGGAGATGGAGATGGG + Intergenic
1152345902 17:79751571-79751593 GACAAAAAGGAGATGGGAGGTGG + Intergenic
1152432145 17:80254403-80254425 GAGAAGAAAGGGGTGGAGGGAGG - Intergenic
1152878139 17:82800049-82800071 GAAGACAAGGAGATGGAGGAAGG - Intronic
1152969772 18:150260-150282 GAGAATAAAGAAATTGAAGGGGG - Intergenic
1153298964 18:3576248-3576270 AAAAAAAAGGAGTTGGAGGGTGG - Intronic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155255875 18:23997622-23997644 GAAAAGAAAGAGAGGGAGGGAGG + Intronic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155705048 18:28799799-28799821 GAAAGGAAGGAAATGGAGGGAGG - Intergenic
1155878656 18:31117464-31117486 GAGAACAAAGAGAGGAAGGGAGG - Intergenic
1155999513 18:32369512-32369534 GAATATATGGAGATGGATGGAGG + Intronic
1156257434 18:35411121-35411143 GAGGAGGAGGAGATGGAAGGGGG + Intergenic
1156472869 18:37388431-37388453 GAGAAGAAGGAGAGAGAAGGAGG - Intronic
1156501958 18:37565865-37565887 GAGAGAGAGGAGAGGGAGGGAGG - Exonic
1157100636 18:44725808-44725830 AAGAAAACGGAGTTGGAGGGGGG - Intronic
1157331495 18:46707367-46707389 GAGAAAAAAGAGATGCAGAGAGG - Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157470405 18:47983925-47983947 GAGAAAAAGGAGAGAGGGGGAGG - Intergenic
1157505750 18:48225266-48225288 GAGAAAAGGGAGAGGGAGAGGGG + Intronic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1159823731 18:73178732-73178754 GAGAATCAAGAGATGGAGAGGGG + Intronic
1159956064 18:74519333-74519355 GAAAAAAAGGAAATGGAGAGAGG - Intronic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160354203 18:78213235-78213257 GAAAATAAGTAAATGGTGGGGGG - Intergenic
1160448670 18:78947107-78947129 GAGAGGAAGAGGATGGAGGGAGG + Intergenic
1160470627 18:79129499-79129521 GAGAAAAAGGAGGGGCAGGGGGG - Intronic
1161101559 19:2424402-2424424 GAGGATGGGGAGATGGGGGGTGG - Intronic
1161256000 19:3310063-3310085 GAGGAGAGAGAGATGGAGGGAGG - Intergenic
1161329082 19:3677929-3677951 GAGAATGGAGGGATGGAGGGAGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161734117 19:5979913-5979935 GGGAACAAGGGGAGGGAGGGAGG - Intergenic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1163371988 19:16906292-16906314 GAGAAGAGAGAGAGGGAGGGAGG - Intronic
1163484991 19:17580265-17580287 GGGAAAAAAGAGATGGAGGAAGG - Intronic
1163779755 19:19240069-19240091 GAGGATGAGGAGCAGGAGGGAGG - Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164515558 19:28932459-28932481 TAGAACCAGGAGATGGAGGGGGG - Intergenic
1164654488 19:29910502-29910524 GAGATGCAGGAGAGGGAGGGAGG - Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164833171 19:31338803-31338825 AAGAAAAAAAAGATGGAGGGAGG - Intronic
1165105799 19:33469126-33469148 GAAAGTAAGGGGTTGGAGGGCGG - Intronic
1165742160 19:38210888-38210910 GGGAAGAAGGAGGTGGATGGAGG + Intergenic
1165934914 19:39383450-39383472 GAAGATCAGGAGCTGGAGGGAGG - Intronic
1166067544 19:40368811-40368833 GATACTCAGGAGATGGAAGGAGG + Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166664946 19:44673837-44673859 CAGAAGAAGGTGATTGAGGGAGG + Intronic
1166981772 19:46635549-46635571 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981798 19:46635619-46635641 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981814 19:46635657-46635679 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981830 19:46635695-46635717 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981871 19:46635804-46635826 GAGGATGGGGTGATGGAGGGAGG + Intergenic
1167043383 19:47036069-47036091 GAGGAAGAGGAGACGGAGGGCGG - Exonic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167252456 19:48407311-48407333 GAGAGGAAGGAGATGGACAGAGG - Intronic
1167259576 19:48450800-48450822 GAGAACACGGTGAGGGAGGGTGG + Exonic
1167635724 19:50654273-50654295 GAAAAGAGAGAGATGGAGGGAGG - Intronic
1167980751 19:53272989-53273011 GAGAAGGAGGACATGGAAGGTGG + Intergenic
1168153620 19:54461639-54461661 AAGAATGCGGAGAGGGAGGGAGG - Exonic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168257017 19:55172731-55172753 GAAAAAAAAGAGAGGGAGGGAGG + Exonic
1168458737 19:56537010-56537032 GTGAATAGGGAGAAGGGGGGTGG + Intergenic
925466537 2:4111108-4111130 GAGAGAAAGGAAACGGAGGGAGG - Intergenic
925608001 2:5678661-5678683 GAGCATATTGAGTTGGAGGGTGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925768886 2:7263231-7263253 GGAAAGAAGGAAATGGAGGGAGG - Intergenic
925803353 2:7624603-7624625 GAGAATAAGGACTGGGAAGGTGG - Intergenic
925881710 2:8358123-8358145 GAGAGACAGGAGATGGAGGGTGG + Intergenic
925948374 2:8887908-8887930 TAGAGTAAGGAAATGGAGGGAGG - Intronic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927187353 2:20491313-20491335 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
927659517 2:24981048-24981070 GAGAAGAAGGAGGGGGAGGGGGG + Intergenic
927927400 2:27023586-27023608 GAGAGTCGGGAGGTGGAGGGAGG - Intronic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928138774 2:28709521-28709543 GGGAACAAAGAGATGGAGGTGGG + Intergenic
928194602 2:29206187-29206209 GAGAAGAAAGGGAGGGAGGGAGG - Intronic
928197069 2:29223608-29223630 GAGGATATGGAGATCCAGGGAGG - Intronic
929053622 2:37857776-37857798 GAGAACAGGGGGATGGCGGGAGG + Intergenic
930679820 2:54245031-54245053 GAGGATAGGGAGATGGGGGAAGG - Intronic
931062660 2:58548407-58548429 GATAGTAAGGAAATGAAGGGAGG - Intergenic
931205340 2:60140843-60140865 GAGGAGAAGGAGGGGGAGGGGGG - Intergenic
931680958 2:64750096-64750118 GTGAATAAGGAGCTGAGGGGCGG + Intronic
931787760 2:65635920-65635942 GAGAGGGAGGAGACGGAGGGAGG + Intergenic
931809979 2:65845382-65845404 GAGAATAGGGGCATGGAGTGGGG + Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
931908439 2:66868512-66868534 GAGAGAAAAGAGATGGAGAGTGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932196562 2:69788885-69788907 AAGAAGGAGGAGAGGGAGGGAGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932613309 2:73215529-73215551 GAGACTATGGAGATGGAGATAGG - Intronic
932742905 2:74305696-74305718 AAGAAAAGGGAGTTGGAGGGAGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
933999460 2:87695442-87695464 GTGAATAAGGAGTTAGAAGGTGG + Intergenic
934047332 2:88183591-88183613 GGGAAGAAGGAGAGCGAGGGAGG - Intronic
934652317 2:96099737-96099759 GAGAAGGAGGAGGTGGAGGAAGG + Intergenic
934935362 2:98461304-98461326 GAGAAGAAGGAAGTGAAGGGCGG + Intronic
935043335 2:99455887-99455909 GTGAAAAAGCAGGTGGAGGGGGG - Intronic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
936294394 2:111255449-111255471 GTGAATAAGGAGTTAGAAGGTGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936483824 2:112909649-112909671 GGGAAGATGGAGATGCAGGGAGG - Intergenic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937511061 2:122595371-122595393 GACCATATGGAGATGGTGGGTGG - Intergenic
938023916 2:127928293-127928315 GAGAATAAGGGGATGAAGAGAGG + Intergenic
938312953 2:130306047-130306069 GAGAATACTGAGATGCAGAGAGG + Intergenic
938716457 2:134026775-134026797 GAGAACGAGGAGATCCAGGGTGG + Intergenic
939222369 2:139318929-139318951 TAGAATAAAGAGATGGGTGGGGG - Intergenic
939443398 2:142277596-142277618 GAGAAGAAAGAGATGGAGATGGG - Intergenic
939683311 2:145166498-145166520 TAGAAAGAGGAGGTGGAGGGGGG - Intergenic
939733850 2:145819316-145819338 GGGAAGGAGGGGATGGAGGGAGG - Intergenic
940038992 2:149339752-149339774 GAGAATAAGGATGAGCAGGGGGG - Intronic
940372921 2:152922683-152922705 AAGAAGAAAGGGATGGAGGGAGG - Intergenic
940897356 2:159093733-159093755 GAGAAGAGGGAGGGGGAGGGGGG - Intronic
941013238 2:160325204-160325226 AAGAGTAAGGAGATGAGGGGTGG + Intronic
941029573 2:160494672-160494694 GACAATTAGGAGATGGAGAGAGG - Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941947795 2:171119354-171119376 GAGAACAAGAAGGTGGTGGGGGG - Intronic
942398291 2:175575294-175575316 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
942444716 2:176070470-176070492 GAGAAAAATGAGGTGGAGGTGGG - Intergenic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
942622657 2:177864207-177864229 GAAAATAGGGAGATGTAGGTCGG + Intronic
942719960 2:178940218-178940240 AAGAATAAAGAAATGGGGGGAGG + Intronic
942947078 2:181683417-181683439 GAAAATAAGGAGGAGGAGCGGGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943994132 2:194737205-194737227 GAAAATAAGGAGATGGCAGAAGG + Intergenic
944085129 2:195836973-195836995 GAGAGAAAAGAGATGGAGAGAGG - Intronic
944208640 2:197183822-197183844 GATAAGCAGGGGATGGAGGGAGG - Intronic
944382840 2:199131564-199131586 GAGATTGAGGAGATTGAGAGAGG - Intergenic
944635152 2:201668875-201668897 GAGAAGAAGGTGAGGGAGAGAGG - Intronic
945155165 2:206830429-206830451 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
945863008 2:215145145-215145167 GAGAAGAAGGAAATGGAAGGGGG - Intergenic
945987531 2:216367312-216367334 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
946946585 2:224828445-224828467 AAAAATAAAGAGGTGGAGGGAGG + Intronic
947006067 2:225512791-225512813 GAAAAGAAAGAGAGGGAGGGAGG - Intronic
947377733 2:229513884-229513906 GAGGACAGGGAGAGGGAGGGAGG - Intronic
947448537 2:230183484-230183506 GAGAAGAAGGAGAGGGCGGGTGG + Intronic
947515687 2:230801978-230802000 GGAATTAAGGAGATGGAGAGGGG + Intronic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948036206 2:234860098-234860120 GAGAAGGAGGAGATGTGGGGTGG + Intergenic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948127475 2:235575163-235575185 GAGAATAAAGAGATGGTGGTTGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1168806012 20:672764-672786 GAAGATGAGGAGAGGGAGGGAGG - Intronic
1169416577 20:5422348-5422370 GAGACTCAGAAGCTGGAGGGTGG + Intergenic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1170327404 20:15171732-15171754 GAGAATAATGGGATAGAAGGAGG - Intronic
1170577894 20:17678401-17678423 AAGAAAAAGGAGTGGGAGGGGGG - Intronic
1170680589 20:18522078-18522100 GAGAAGAAGGGAATGGAGGGCGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171059575 20:21943280-21943302 GAGAAAGAGGAGCTGGAGGAAGG - Intergenic
1171186893 20:23129187-23129209 GAGGATAGAGAAATGGAGGGAGG + Intergenic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1171369806 20:24654608-24654630 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1171486390 20:25489460-25489482 GGGAGTAAGGAGAAGGAGGGGGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172227035 20:33311953-33311975 GAGAAGAAGGAGGTGGTGTGGGG - Intergenic
1172371432 20:34395397-34395419 GAGAGAAAGAAGATTGAGGGAGG + Intronic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1173058093 20:39635835-39635857 GAGAACTAGGAGGTGGTGGGAGG + Intergenic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173404339 20:42752037-42752059 GAGTATAAGAAGAGGGAGGGAGG - Intronic
1173619198 20:44423765-44423787 GGGGAATAGGAGATGGAGGGCGG - Intronic
1173681460 20:44885482-44885504 GAGAAGAAGGAAATGGGGCGGGG - Intergenic
1173765298 20:45602180-45602202 GATAACCAGGAGCTGGAGGGAGG - Intergenic
1173790002 20:45822401-45822423 GGGAAGAAAGAGAGGGAGGGAGG + Intergenic
1174292622 20:49519735-49519757 CAGAAGAGGGAGATGGCGGGAGG - Intronic
1174776496 20:53347492-53347514 TTGAATAAGGAGTTGGGGGGTGG - Intronic
1175345074 20:58267055-58267077 GAGAAGAATGGGATGGAGGAGGG + Intergenic
1175725881 20:61318030-61318052 GAGACTAAAGGGCTGGAGGGTGG + Intronic
1176326775 21:5508299-5508321 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176400982 21:6312652-6312674 GAGACTAAGGAGAGAGAGTGGGG - Intergenic
1176436175 21:6676452-6676474 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176460437 21:7003522-7003544 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1176483998 21:7385300-7385322 GAGACTAAGGAGAGAGAGTGGGG + Intergenic
1177845127 21:26279917-26279939 GATAATAAGGATGTGGGGGGTGG + Intergenic
1177889992 21:26793562-26793584 GAGAATGCGGAAATGGAGGTAGG + Intergenic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1179131380 21:38640335-38640357 GAGAAACAGGAGATGGGGGAAGG + Intronic
1179482111 21:41685117-41685139 TACAAGAGGGAGATGGAGGGAGG - Intergenic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1181411041 22:22719951-22719973 GAGAAGGAGGAGATGGAGCAGGG + Intergenic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1181844722 22:25698063-25698085 GGAAAAAAGGAGAGGGAGGGAGG + Intronic
1181844731 22:25698088-25698110 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1181998592 22:26902679-26902701 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182878992 22:33717145-33717167 TAAATGAAGGAGATGGAGGGAGG - Intronic
1182916429 22:34037003-34037025 GAGAAGAAGTGAATGGAGGGTGG - Intergenic
1182931478 22:34178308-34178330 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183067678 22:35374477-35374499 GATACTCAGGAGATGGAGGCAGG + Intergenic
1183130160 22:35826585-35826607 GAAAAACAGGAGATGCAGGGGGG - Intronic
1183135858 22:35886961-35886983 GACAAGACGGAGAGGGAGGGTGG - Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183392314 22:37552523-37552545 GAGAGCAAGAAGTTGGAGGGGGG - Intergenic
1183509586 22:38227058-38227080 GAGATGGAGGAGATGGGGGGTGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1184449735 22:44575846-44575868 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449765 22:44575980-44576002 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184883635 22:47328463-47328485 AAGATTATGGAGATGGATGGTGG + Intergenic
1184959319 22:47917740-47917762 GGGAGGAAGGAGAGGGAGGGAGG - Intergenic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
1184959380 22:47917957-47917979 GGGAGAAAGGAGAGGGAGGGAGG - Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
949141529 3:639387-639409 GGGAATAAGGAAAAGGAGTGTGG - Intergenic
949219024 3:1607217-1607239 GAGGAGGAGGAGCTGGAGGGAGG + Intergenic
950033586 3:9867973-9867995 GGGAATAAGGGGGTGCAGGGAGG - Intronic
950895386 3:16445317-16445339 GACAAAAAGGAGATATAGGGAGG + Intronic
950948644 3:16976722-16976744 GAGAGTGGGGAGATGGAGGGAGG + Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952276898 3:31886029-31886051 AAGGAGAAGGAGATGGGGGGTGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952954834 3:38550466-38550488 GAGATGGAGGAGCTGGAGGGTGG + Exonic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953571559 3:44075804-44075826 GAGAATCAAGAGATGGGGTGTGG + Intergenic
953625447 3:44567185-44567207 GAAAAGAAAGAGAGGGAGGGAGG + Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954697263 3:52434565-52434587 GAGGATATGGAGATGGATAGAGG - Exonic
954716483 3:52529336-52529358 TAGAGGAAGGAGATGCAGGGAGG + Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955369132 3:58335907-58335929 GGGAGTGAAGAGATGGAGGGAGG - Intronic
955378945 3:58421581-58421603 GAAAAAAAGGAACTGGAGGGAGG + Intronic
955400173 3:58585820-58585842 GAGAATACAGGGATGTAGGGGGG - Intronic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955699989 3:61672760-61672782 GAGAAGAGGGAGAGGGAGAGAGG + Intronic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956190379 3:66602221-66602243 GGGAAGGAGGAAATGGAGGGAGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956217005 3:66859120-66859142 GAGAATGAGGTGGTGGAGAGGGG - Intergenic
956726510 3:72160947-72160969 GAGAATAAGCAGATCGTGGAAGG + Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957701325 3:83718008-83718030 GAGAAAAAAGAAAGGGAGGGAGG + Intergenic
957825038 3:85430592-85430614 GCGAATAAGGAGAAAGGGGGCGG + Intronic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958484534 3:94687187-94687209 AAGAATAAGGCTAGGGAGGGAGG - Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960812300 3:121636603-121636625 GAGAATCAGAGGATAGAGGGAGG + Intronic
960905936 3:122601421-122601443 GAGATTTTGGAGAAGGAGGGAGG - Intronic
961174391 3:124821737-124821759 GAGTATGATGAGCTGGAGGGAGG - Intronic
961366229 3:126401691-126401713 GAGGGGGAGGAGATGGAGGGAGG + Intronic
961460290 3:127045673-127045695 GAGGAGAGGGAGAGGGAGGGAGG + Intergenic
961494958 3:127284655-127284677 GAGTGTAAGGAGATGGAGTAGGG + Intergenic
962653580 3:137519837-137519859 GAGAATAATGCGAAGGAGAGAGG + Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963521069 3:146360574-146360596 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
963531291 3:146476242-146476264 GAGAGTAAGGAAATGCAGTGTGG + Intronic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
963763072 3:149304978-149305000 GAAAATAAAGAGATGGAAAGAGG - Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
966030314 3:175338425-175338447 GAGAATAAGGAGATAGGAGTTGG + Intronic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
966909600 3:184551634-184551656 GAGACTGAGGAGATAAAGGGAGG + Intronic
967391629 3:188961816-188961838 GAGAAAAAAGAAATGGAAGGTGG - Intronic
968020068 3:195378045-195378067 GTGAAAAAGAAGAGGGAGGGAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968442218 4:629714-629736 GGGAATCCGGAGATAGAGGGAGG + Intronic
968865584 4:3209218-3209240 AGGTATGAGGAGATGGAGGGAGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970663315 4:18309867-18309889 GGGAATAAGGAGTTGGTAGGAGG + Intergenic
971181404 4:24331409-24331431 CAGGATAAGGAGATGGTGAGTGG - Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971965646 4:33552101-33552123 GGGAATAGGGAGATGGGGGAGGG - Intergenic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
972798591 4:42448379-42448401 GAAAAGAAAGAGAAGGAGGGAGG - Intronic
973980411 4:56304077-56304099 GAGAAGAGGCAGAGGGAGGGAGG - Intronic
974321050 4:60350398-60350420 AAGCATAAGGAGATGGATAGTGG + Intergenic
974406606 4:61480174-61480196 GAGAAGGAGGAGATGGAGAGAGG - Intronic
976078014 4:81321320-81321342 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977330547 4:95631993-95632015 GAGATTAAGGGAATGGAGGTGGG - Intergenic
977664800 4:99633530-99633552 TGGAATTGGGAGATGGAGGGAGG + Intergenic
977751435 4:100614387-100614409 GAAGATATGGAGTTGGAGGGTGG - Intronic
978089545 4:104697935-104697957 GAGTATAAGGAGAAGAAAGGGGG + Intergenic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979152891 4:117342131-117342153 GAGAAAAAAGAAATGCAGGGTGG - Intergenic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979732910 4:124045813-124045835 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
979829732 4:125284761-125284783 GAGAATCTGGAGATGGCAGGGGG - Intergenic
980213052 4:129814407-129814429 GAAAAGAAAGAGAGGGAGGGAGG + Intergenic
980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG + Intergenic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981118428 4:141019578-141019600 GAGAATTTGGTGGTGGAGGGTGG - Intronic
981172724 4:141643569-141643591 GAAAATAAGGAGAAGGGGAGTGG - Intronic
981489946 4:145328460-145328482 GAGAAAAGAGAGAGGGAGGGAGG + Intergenic
981619344 4:146676399-146676421 GAGAAGGAGGAGAGGGTGGGGGG - Intergenic
982054838 4:151538136-151538158 GAGTATAAGGAGATGGTTGAGGG + Intronic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
983001219 4:162417383-162417405 GAGAATGGGGAGATAGAGGTAGG - Intergenic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984021866 4:174495153-174495175 GAGAACATGGAGCTGGAAGGAGG - Intronic
984224963 4:177023598-177023620 GAGAAAGAAGGGATGGAGGGAGG + Intergenic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
985005274 4:185528751-185528773 GAGAAAAAGGAAATAGAGAGAGG + Intronic
985140939 4:186840376-186840398 GAGGAGAAGGAGGGGGAGGGAGG - Intergenic
985232118 4:187830324-187830346 GAGAATGAGGAGATAGATGTTGG - Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985509283 5:303065-303087 GAAAGGAAGGAGCTGGAGGGAGG + Intronic
985738990 5:1603827-1603849 GAAAGGAAGGAGCTGGAGGGAGG - Intergenic
985781582 5:1874445-1874467 GAGAAAGAGGAGAGGGAGAGAGG + Intergenic
985861742 5:2476877-2476899 GAGAGAAATGAGAGGGAGGGAGG + Intergenic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986495461 5:8337495-8337517 GAAAAGAAGGAGATGGAAGCAGG - Intergenic
986572709 5:9181718-9181740 GAGTATGTGGAGATGGAGAGGGG + Intronic
986951649 5:13093809-13093831 GAGAATAGGGAGATGGGTTGTGG + Intergenic
987523882 5:19023075-19023097 GAGATTGAGAAGAAGGAGGGAGG - Intergenic
987827782 5:23055847-23055869 GAGAATAAGGAGAGTGAAGGAGG + Intergenic
988211986 5:28215856-28215878 GAGAAGAAGGAGGTGGGGGAGGG - Intergenic
989385062 5:40846757-40846779 TAAAATAAGGTCATGGAGGGGGG - Intronic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991304143 5:65158898-65158920 GAGATTGAAGAAATGGAGGGAGG - Intronic
991957881 5:72014098-72014120 GAGAAAGAAGAGATGGAGGGGGG + Intergenic
992205630 5:74427826-74427848 GGGAGTAAGGAGTTGGAAGGTGG + Intergenic
992301270 5:75383355-75383377 GATAAATAGTAGATGGAGGGAGG - Intronic
992729121 5:79640317-79640339 TAGAAGAATGGGATGGAGGGTGG + Intronic
992874880 5:81044024-81044046 GAGAATGAGGAGAGGGATTGGGG + Intronic
993132038 5:83911101-83911123 AAGAAACAGGAGATGGAGTGAGG - Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
993900647 5:93582118-93582140 GAGAAGATGGAGAGGGGGGGAGG - Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
995086573 5:108117978-108118000 AAAAAGCAGGAGATGGAGGGAGG + Intronic
995134885 5:108670639-108670661 GAGAATGAGGAGATGACAGGCGG + Intergenic
995248367 5:109961191-109961213 GAGCATAAGAAGATGGAAGAGGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
996156319 5:120107175-120107197 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
996167112 5:120237839-120237861 GAGGAAGAGGAGAGGGAGGGGGG - Intergenic
996780932 5:127186038-127186060 GATAATAAGGAAATGGGGAGGGG - Intergenic
996905201 5:128591514-128591536 GAAAATAGTGAGGTGGAGGGAGG + Intronic
997010033 5:129865808-129865830 GGGAGAAAAGAGATGGAGGGAGG + Intergenic
998187650 5:139994919-139994941 GAAGATGAGGAGATGGAAGGAGG + Intronic
998206364 5:140159543-140159565 GAAAAGAAGGGGATGGAGTGAGG - Intergenic
998304044 5:141055095-141055117 GAAAAAACGGAAATGGAGGGTGG + Intergenic
998617925 5:143761317-143761339 TAGATTAAGGACATGGAGGTGGG + Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999030383 5:148284109-148284131 GAGAGGAAGGAAAGGGAGGGAGG - Intronic
999802814 5:155053556-155053578 GAGGAGAAGAGGATGGAGGGCGG + Intergenic
999806049 5:155082333-155082355 GAGAATAAAGGGATTGAAGGAGG + Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
999909726 5:156184682-156184704 GGGAATAAGGAGGTGGTGGTAGG - Intronic
1000256463 5:159543412-159543434 GAAAATAAAGAGAAGGAGTGGGG + Intergenic
1000287586 5:159840110-159840132 GAGAGTCAAGAGATGGAGAGGGG - Intergenic
1000340193 5:160271038-160271060 AAGATTTAGGAGGTGGAGGGAGG + Intronic
1000439562 5:161249662-161249684 GAGAGTAGAGACATGGAGGGAGG - Intergenic
1000963663 5:167629880-167629902 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1000975747 5:167762448-167762470 GAAAATAACGAGAGGAAGGGAGG - Intronic
1001154606 5:169262300-169262322 GAGAATAAAGATATGGTGAGAGG + Intronic
1001241944 5:170077891-170077913 GAGAAGAGAGAGAAGGAGGGGGG - Intronic
1001344368 5:170877626-170877648 GAGGTTAGGGAGATGGATGGGGG - Intronic
1001618916 5:173065600-173065622 GGGAATAAAGAGAGAGAGGGAGG - Intronic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004131201 6:12921620-12921642 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1004138389 6:12990801-12990823 GAGAATCAGGAGCTGGAGAGGGG + Intronic
1004233321 6:13852025-13852047 GAGGAGAGGGAGAGGGAGGGAGG - Intergenic
1004278499 6:14258885-14258907 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1004869534 6:19890757-19890779 GGGAAAAAAGAGAGGGAGGGAGG - Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1005857648 6:29874780-29874802 GAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1005871398 6:29976525-29976547 GAGCAGAAGGAGCTGGAGGTAGG - Intergenic
1005959943 6:30687317-30687339 GACAATGAGGAGAGGGAAGGGGG + Exonic
1006094680 6:31648623-31648645 GAGAAAAGGGAGAGGGAGGGTGG + Intronic
1006168762 6:32081269-32081291 GAGAAGGCGAAGATGGAGGGAGG + Intronic
1006340547 6:33444004-33444026 GGGAAGAAGGAGATGGGGGGTGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007825414 6:44596195-44596217 GAGGCTAAGGATATGGAGGGAGG - Intergenic
1007877068 6:45116210-45116232 GAGAAGAAGGAGAGGAAGGGAGG - Intronic
1008246759 6:49184684-49184706 AAGAAGAAGGAGGTGGGGGGAGG - Intergenic
1008274108 6:49523544-49523566 GAGAACATGGATCTGGAGGGGGG - Intronic
1008424621 6:51342687-51342709 TATAATAAAGAGATGGAAGGAGG + Intergenic
1008921741 6:56850121-56850143 GAGAAAGGGGAGGTGGAGGGAGG - Intronic
1009564427 6:65293979-65294001 GAGAGAAAGCAAATGGAGGGGGG + Intronic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1009937775 6:70253841-70253863 GAGAAAAAGGAAATGGTAGGAGG + Intronic
1009970241 6:70617561-70617583 GAGAATATGGGGTGGGAGGGGGG + Intergenic
1010809396 6:80281743-80281765 GAGAATGAGGACAGGGAGAGGGG - Intronic
1010905446 6:81481242-81481264 GAAAATTAGGAGTTGGAGGAAGG + Intergenic
1011083317 6:83512393-83512415 GAGGAGACGGAGAGGGAGGGCGG - Intergenic
1011085624 6:83537432-83537454 GAGAAAAAGAAAAGGGAGGGAGG - Intergenic
1011277230 6:85643066-85643088 GAGAAGGAGGAGCTGGAGGAGGG - Exonic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1011763623 6:90594900-90594922 GAGGATAAAGAGATGATGGGAGG + Intergenic
1011837354 6:91450007-91450029 GAGAATAAGGAGTTGAAGACAGG - Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1013309574 6:108880721-108880743 GAGAAGAGGGAGAGGGAAGGGGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013550721 6:111205190-111205212 GAGAAAAAGGAGATGGTGTTGGG + Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1015591454 6:134826686-134826708 GAAAAGAAGGAGAGGGAAGGGGG + Intergenic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1015727054 6:136309841-136309863 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1017830715 6:158126476-158126498 GGGAGGGAGGAGATGGAGGGAGG + Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018224485 6:161615263-161615285 GTGGATGAGGAGATGAAGGGAGG - Intronic
1018461690 6:164004773-164004795 AAGAAAAAGAAGAGGGAGGGAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019535285 7:1526144-1526166 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019535309 7:1526231-1526253 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019550149 7:1598128-1598150 GTCATTAAGGAGATGGAGGCTGG + Intergenic
1019647178 7:2137195-2137217 GAGAATAGGGAGATGGGAGAAGG - Intronic
1019805054 7:3117575-3117597 GAGAAAGAGGAGAGGGAGGGAGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020604552 7:10320035-10320057 AAAAATGAGGAAATGGAGGGAGG - Intergenic
1020929858 7:14379463-14379485 GAGAATAAGGAAAGAGAGTGGGG + Intronic
1021279105 7:18694903-18694925 GAAAATGAGGAGTAGGAGGGAGG - Intronic
1021334314 7:19379889-19379911 GATTATAGGGAGATGGAAGGAGG - Intergenic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1022278726 7:28883276-28883298 GAGAAGAAAGAAAGGGAGGGAGG - Intergenic
1023088646 7:36597621-36597643 GAGAAAAAGGTGAGGGAGTGGGG - Intronic
1023615168 7:42012378-42012400 GAGAAGAAGAAAAGGGAGGGGGG - Intronic
1023655928 7:42420831-42420853 GAGAAAGAGGAGAAAGAGGGAGG + Intergenic
1023778483 7:43633832-43633854 AAGAAAGAGGAGAGGGAGGGTGG - Intronic
1024141721 7:46468877-46468899 GAGAATACAGAGAGGGAAGGAGG - Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024436793 7:49365884-49365906 GAGAAGAATGAGAGTGAGGGCGG - Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024797260 7:53035440-53035462 GAGAAAGGGGAGAGGGAGGGAGG + Intergenic
1025047923 7:55708229-55708251 GAGGGGAAGGAGATGCAGGGTGG - Intergenic
1026134762 7:67650157-67650179 GTGAAACAGGACATGGAGGGTGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026217801 7:68365040-68365062 GAGAGCCAAGAGATGGAGGGAGG + Intergenic
1026493714 7:70884970-70884992 GAGAGGAAGGAGCTGGAGAGAGG + Intergenic
1026638334 7:72103745-72103767 GAGAAGATGGAAATGGAGGGGGG + Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026890886 7:73981542-73981564 GAAAGGAAGGAGAGGGAGGGAGG + Intergenic
1027609710 7:80345462-80345484 GAGACTCAGAAGGTGGAGGGTGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028837794 7:95394268-95394290 GACAATAAGGAAAGGGAGGGAGG + Intronic
1029412958 7:100427150-100427172 GAGAAGAGAGAGAGGGAGGGAGG - Intronic
1029418040 7:100455977-100455999 GGGAATAAGGACCTAGAGGGAGG - Intergenic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1030170997 7:106602699-106602721 GAGATTGAGTAGATGGAGTGAGG + Intergenic
1030185630 7:106759027-106759049 CAGAATAAGGTGGTGGTGGGGGG - Intergenic
1030197235 7:106864251-106864273 GGGAATTCTGAGATGGAGGGAGG + Intergenic
1030207696 7:106966820-106966842 GAGAAGCAGGGGATGGAGTGGGG + Intergenic
1030545654 7:110892076-110892098 GAGAAACAGGAGGTGGAAGGAGG - Intronic
1030766744 7:113419697-113419719 GATAATATGGAGATGATGGGTGG + Intergenic
1030921717 7:115397696-115397718 GAGAAAAAGGAGATTGAGGTTGG - Intergenic
1031010861 7:116524948-116524970 GAAAAAAAGGCGCTGGAGGGGGG - Exonic
1031224313 7:119015366-119015388 GACTATATGGAGGTGGAGGGTGG + Intergenic
1031351642 7:120739221-120739243 GAGAATGAAGGGAGGGAGGGAGG + Intronic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032474763 7:132204193-132204215 GAGAGATAGGAGGTGGAGGGTGG + Intronic
1032738753 7:134717519-134717541 GAAAATAAGGGGATAGAAGGTGG + Intergenic
1032948715 7:136882437-136882459 GAGAAGAAGGAGGGGGAAGGAGG - Intronic
1033241595 7:139684243-139684265 GAGAAGAAGGAGAGAGATGGGGG - Intronic
1033356872 7:140607282-140607304 GGGAACAAGGAGAGGAAGGGAGG + Intronic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1034537922 7:151737582-151737604 GAAAACAAGGGGATGGAGTGTGG + Intronic
1035130413 7:156647349-156647371 GAGACTCAGGAGGCGGAGGGTGG - Intronic
1035356808 7:158280591-158280613 GAGAACCAGGAGATGAAAGGAGG + Intronic
1036111413 8:5907147-5907169 AGGAATAGAGAGATGGAGGGAGG - Intergenic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036182662 8:6598439-6598461 GAGAAGAAGGGGATGGGGTGGGG + Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037500832 8:19484062-19484084 GAGACTAATGGGGTGGAGGGAGG - Intronic
1037571811 8:20164376-20164398 GAGGATGAGGAGCTGAAGGGAGG + Intronic
1037608072 8:20454152-20454174 GTGAACAAGGAGACAGAGGGTGG - Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1037920641 8:22803085-22803107 GAGAGTGAGGAGAGGCAGGGAGG - Intronic
1038117197 8:24570704-24570726 GAAAATAGAGAGAGGGAGGGAGG - Intergenic
1038310891 8:26445471-26445493 GAGGACAAGGAGATGAAGCGTGG + Intronic
1038324818 8:26564924-26564946 GAGACTCAGAAGAAGGAGGGTGG - Intronic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038783134 8:30585836-30585858 GAGCTTAGGGAGATGGAGGTGGG + Intronic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1039498275 8:37997570-37997592 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
1041061551 8:54039706-54039728 TAGAAAAAGAACATGGAGGGGGG - Intergenic
1041098130 8:54369853-54369875 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041315724 8:56560185-56560207 GAGAACAAGGAGGGAGAGGGAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1042015132 8:64300734-64300756 AAGAATAAGGGGGTGGATGGAGG - Intergenic
1042027174 8:64436550-64436572 GAGAATGAGGAGCTAGAGAGAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042661178 8:71156189-71156211 GAGAATGAAGACCTGGAGGGAGG + Intergenic
1042905258 8:73766048-73766070 GAGGAAAAGGGGAGGGAGGGAGG + Intronic
1043075256 8:75690744-75690766 GAGAGTACAGAGATGGAGGAGGG - Intergenic
1043336957 8:79187830-79187852 GAGAAAAAGGAAATGAAGGAAGG + Intergenic
1045396526 8:101766064-101766086 GAAAATAAGGAGATGTTGGTGGG - Intronic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046066806 8:109207133-109207155 GAGCAGTAGGGGATGGAGGGAGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046571755 8:115974935-115974957 GAGAAGAAGGAGAGAGATGGAGG + Intergenic
1046764071 8:118050869-118050891 AAGAATTAGAAGGTGGAGGGAGG + Intronic
1046870825 8:119204382-119204404 GGGAAGAAGGGGATGGAGGAGGG + Intronic
1046983569 8:120362797-120362819 GAGTAGGAGGAGATGGAGGGAGG + Intronic
1047673365 8:127172734-127172756 GAGGAAAAGTAAATGGAGGGTGG + Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048234489 8:132676168-132676190 GAGAATAGGGAAATTGATGGAGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048995202 8:139789784-139789806 GAGAATCATGTGATCGAGGGAGG + Intronic
1049286766 8:141780150-141780172 GAGCAAAAGGAGGTGGTGGGGGG + Intergenic
1049356699 8:142192719-142192741 GAGAAGAGTGAGAGGGAGGGAGG + Intergenic
1049391333 8:142373139-142373161 GAGAAGAAAGAGAGGAAGGGAGG + Intronic
1049696661 8:143987291-143987313 GGGAAGTAGGAGATGGAGAGTGG - Intronic
1049784271 8:144443134-144443156 GTGGATGAGGAGCTGGAGGGTGG - Exonic
1050094651 9:2051454-2051476 GGAAATGAGGAGATGGGGGGTGG - Intronic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050797526 9:9562766-9562788 GGGGATAAGGAGATGTGGGGTGG - Intronic
1051223866 9:14878396-14878418 GAGAGTAGAGAGGTGGAGGGAGG - Intronic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052337175 9:27331825-27331847 GAGAAAAAGGAGACTGAGTGTGG + Intronic
1052475915 9:28958730-28958752 GAGAAGAAGGGAAGGGAGGGGGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053432473 9:38052204-38052226 GGGACTAAGGAGATGGGGAGGGG - Intronic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1055381325 9:75710102-75710124 GAGAGAGAGGAGAGGGAGGGAGG - Intergenic
1055558183 9:77496980-77497002 GAGGAATACGAGATGGAGGGTGG - Intronic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056300798 9:85238857-85238879 GAGAAAAAGGAACTGTAGGGAGG + Intergenic
1056407525 9:86289477-86289499 GAGAAGAAGGATATGGTGTGAGG - Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057202667 9:93151102-93151124 GGGAGTAGGGAGAGGGAGGGAGG + Intergenic
1057408892 9:94799011-94799033 GAGAGTAAGAAAATGGATGGAGG - Intronic
1057456292 9:95215361-95215383 GAGGAGAGGGAGATGGAGAGAGG + Intronic
1057788260 9:98104831-98104853 GAGAGTGAGGAGATGAAAGGAGG + Intronic
1058276495 9:103048042-103048064 GAGAATCAGAAGGGGGAGGGTGG + Intergenic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1058928464 9:109692906-109692928 GAGAAAAGAGAGATGGAGGTGGG - Intronic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059126419 9:111690885-111690907 GAGAAAAAGGGGAGGGCGGGGGG - Intronic
1059138406 9:111829512-111829534 GAAGATAAGGAGAAGAAGGGAGG - Intergenic
1059410086 9:114126440-114126462 AAGAAAGAGGAGAGGGAGGGAGG - Intergenic
1059942773 9:119374012-119374034 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1060106400 9:120876199-120876221 GAGAAAAAGGAGATGGGAGTGGG - Intronic
1060431689 9:123556270-123556292 GATAAAAAGGAGTAGGAGGGTGG + Intronic
1060498186 9:124133240-124133262 GAGACTCAAGAGATGGAGTGAGG + Intergenic
1061258712 9:129467486-129467508 GAGAATGAGGGGGTGGGGGGTGG + Intergenic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1061842441 9:133367133-133367155 GAGAAGAGGGGAATGGAGGGGGG + Intronic
1062163878 9:135096035-135096057 GAGGATAAGGGGAGGGAGAGGGG - Intronic
1062228272 9:135465990-135466012 GGGAGAAAGGAGATGGAGGCAGG + Intergenic
1185460803 X:332085-332107 GAGACAGAGGAGATGGAGAGGGG - Intergenic
1185485869 X:481597-481619 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485886 X:481652-481674 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485926 X:481786-481808 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485932 X:481803-481825 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485977 X:481962-481984 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185575492 X:1169034-1169056 GAGAAGGAGGAGGTGGAGGGAGG + Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185751190 X:2610643-2610665 GAGAGTGAGGAGATAGAGAGAGG - Intergenic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186538273 X:10372338-10372360 GAGATTACAGAGATGGAGAGGGG + Intergenic
1186729255 X:12391184-12391206 ATGAATAAGGAGATGGGGGTGGG - Intronic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1187095436 X:16143011-16143033 GGAAATAAGGGGATGGAAGGAGG - Intronic
1187248892 X:17579474-17579496 GATAAAAAGGAGAGGGAGAGGGG - Intronic
1187435536 X:19265401-19265423 GAGACTCAGAAGGTGGAGGGTGG - Intergenic
1187538489 X:20166667-20166689 GAAAATGAGGGGAGGGAGGGAGG - Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188043181 X:25394336-25394358 GAAAGAAAGGAGATAGAGGGAGG - Intergenic
1188249164 X:27870877-27870899 GAGAATGGGGAGATGTAGGTTGG - Intergenic
1188878819 X:35466864-35466886 GACAAAAAGGAGATTCAGGGGGG + Intergenic
1188900131 X:35722134-35722156 GAGAATAAGTATATGAATGGTGG + Intergenic
1188980183 X:36720428-36720450 GAGAAGAAGAAGAAGAAGGGAGG + Intergenic
1189003788 X:36973853-36973875 CAGAATAGGGAGTTGGAGTGGGG + Intergenic
1189206465 X:39243501-39243523 GGGAGTAGGGAGACGGAGGGAGG - Intergenic
1189335231 X:40167053-40167075 GATATTTTGGAGATGGAGGGAGG - Intronic
1190035323 X:47018203-47018225 GGGAAGAAGGAGATGGGGTGAGG - Intronic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190598070 X:52066215-52066237 GAGAGGAAGGAGATGGGGGAGGG + Intronic
1190610754 X:52187858-52187880 GAGAGGAAGGAGATGGGGGAGGG - Intronic
1190723652 X:53172102-53172124 GAGAGGAAGAAGAGGGAGGGAGG + Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1193164432 X:78264621-78264643 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
1193533717 X:82687029-82687051 GAGACCAAGGAAATGCAGGGTGG - Intergenic
1194183027 X:90737185-90737207 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1195069642 X:101266782-101266804 GAGAATAAGGAGAAAGAATGAGG - Intergenic
1195213209 X:102670159-102670181 GAGAACAAAGAAATGCAGGGTGG - Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195802642 X:108731206-108731228 GAGAAAAAGGGGATGTGGGGGGG + Intronic
1196465622 X:115969088-115969110 GAGACACAGAAGATGGAGGGAGG - Intergenic
1196599821 X:117589426-117589448 GAGAATGAGGAAAAGCAGGGTGG + Intergenic
1197343406 X:125301706-125301728 TAGAATAAAGACATGGAGGTAGG - Intergenic
1197687076 X:129451997-129452019 GAGAATAAAAAAATGGAGGCTGG - Intronic
1197767745 X:130069986-130070008 GAGAGTGAGGGGATGGATGGCGG + Intronic
1198003213 X:132462223-132462245 GAGAAACAGGAGAGAGAGGGAGG - Intronic
1198204350 X:134452158-134452180 GAGAAGAGGGGGAGGGAGGGAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199273344 X:145912113-145912135 GAGAAAAAGGACATGTAGTGAGG + Intergenic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1200154993 X:153970523-153970545 GTGAGGGAGGAGATGGAGGGAGG + Intronic
1200155015 X:153970590-153970612 GAGAGGGAGGAGATGGAGGGAGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200529645 Y:4319139-4319161 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201144717 Y:11057971-11057993 GTGAATGAGTGGATGGAGGGAGG + Intergenic
1201307613 Y:12564075-12564097 GGGAATGAGGGGATGGTGGGAGG + Intergenic
1201575928 Y:15461232-15461254 GAGAAGGAGGAAATGAAGGGAGG - Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1201936933 Y:19419783-19419805 GAGAGTAGAGACATGGAGGGAGG - Intergenic
1202039165 Y:20664802-20664824 GAGAATAAGGGAATGGAGCTGGG - Intergenic
1202186938 Y:22195575-22195597 GATAATCAGGAGTTGGAAGGTGG + Intergenic
1202204422 Y:22390821-22390843 GATAATCAGGAGTTGGAAGGTGG - Intronic
1202593925 Y:26516373-26516395 GAGAGTAAGGAGGTGGTGGAGGG + Intergenic