ID: 1183173630

View in Genome Browser
Species Human (GRCh38)
Location 22:36205777-36205799
Sequence GCCCCCAGCGATGTTTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173630_1183173641 30 Left 1183173630 22:36205777-36205799 CCTGAGCAAACATCGCTGGGGGC No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173630 Original CRISPR GCCCCCAGCGATGTTTGCTC AGG (reversed) Intergenic