ID: 1183173634

View in Genome Browser
Species Human (GRCh38)
Location 22:36205813-36205835
Sequence TGTGTGTGCGTATGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173634_1183173643 4 Left 1183173634 22:36205813-36205835 CCCCCCACCCATACGCACACACA No data
Right 1183173643 22:36205840-36205862 CTTTTGAGACAGGAACAGAAAGG No data
1183173634_1183173644 16 Left 1183173634 22:36205813-36205835 CCCCCCACCCATACGCACACACA No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173634_1183173645 17 Left 1183173634 22:36205813-36205835 CCCCCCACCCATACGCACACACA No data
Right 1183173645 22:36205853-36205875 AACAGAAAGGTGATTACACAGGG No data
1183173634_1183173641 -6 Left 1183173634 22:36205813-36205835 CCCCCCACCCATACGCACACACA No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173634 Original CRISPR TGTGTGTGCGTATGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr