ID: 1183173636

View in Genome Browser
Species Human (GRCh38)
Location 22:36205815-36205837
Sequence GGTGTGTGTGCGTATGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173636_1183173641 -8 Left 1183173636 22:36205815-36205837 CCCCACCCATACGCACACACACC No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173636_1183173644 14 Left 1183173636 22:36205815-36205837 CCCCACCCATACGCACACACACC No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173636_1183173645 15 Left 1183173636 22:36205815-36205837 CCCCACCCATACGCACACACACC No data
Right 1183173645 22:36205853-36205875 AACAGAAAGGTGATTACACAGGG No data
1183173636_1183173643 2 Left 1183173636 22:36205815-36205837 CCCCACCCATACGCACACACACC No data
Right 1183173643 22:36205840-36205862 CTTTTGAGACAGGAACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173636 Original CRISPR GGTGTGTGTGCGTATGGGTG GGG (reversed) Intergenic