ID: 1183173640

View in Genome Browser
Species Human (GRCh38)
Location 22:36205821-36205843
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173640_1183173644 8 Left 1183173640 22:36205821-36205843 CCATACGCACACACACCAGCTTT No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173640_1183173645 9 Left 1183173640 22:36205821-36205843 CCATACGCACACACACCAGCTTT No data
Right 1183173645 22:36205853-36205875 AACAGAAAGGTGATTACACAGGG No data
1183173640_1183173643 -4 Left 1183173640 22:36205821-36205843 CCATACGCACACACACCAGCTTT No data
Right 1183173643 22:36205840-36205862 CTTTTGAGACAGGAACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173640 Original CRISPR AAAGCTGGTGTGTGTGCGTA TGG (reversed) Intergenic