ID: 1183173641

View in Genome Browser
Species Human (GRCh38)
Location 22:36205830-36205852
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173634_1183173641 -6 Left 1183173634 22:36205813-36205835 CCCCCCACCCATACGCACACACA No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173636_1183173641 -8 Left 1183173636 22:36205815-36205837 CCCCACCCATACGCACACACACC No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173633_1183173641 -3 Left 1183173633 22:36205810-36205832 CCTCCCCCCACCCATACGCACAC No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173632_1183173641 0 Left 1183173632 22:36205807-36205829 CCACCTCCCCCCACCCATACGCA No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173630_1183173641 30 Left 1183173630 22:36205777-36205799 CCTGAGCAAACATCGCTGGGGGC No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173637_1183173641 -9 Left 1183173637 22:36205816-36205838 CCCACCCATACGCACACACACCA No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173638_1183173641 -10 Left 1183173638 22:36205817-36205839 CCACCCATACGCACACACACCAG No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data
1183173635_1183173641 -7 Left 1183173635 22:36205814-36205836 CCCCCACCCATACGCACACACAC No data
Right 1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173641 Original CRISPR CACACACCAGCTTTTGAGAC AGG Intergenic