ID: 1183173642 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:36205836-36205858 |
| Sequence | TCTGTTCCTGTCTCAAAAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1183173642_1183173645 | -6 | Left | 1183173642 | 22:36205836-36205858 | CCAGCTTTTGAGACAGGAACAGA | No data | ||
| Right | 1183173645 | 22:36205853-36205875 | AACAGAAAGGTGATTACACAGGG | No data | ||||
| 1183173642_1183173644 | -7 | Left | 1183173642 | 22:36205836-36205858 | CCAGCTTTTGAGACAGGAACAGA | No data | ||
| Right | 1183173644 | 22:36205852-36205874 | GAACAGAAAGGTGATTACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1183173642 | Original CRISPR | TCTGTTCCTGTCTCAAAAGC TGG (reversed) | Intergenic | ||