ID: 1183173642

View in Genome Browser
Species Human (GRCh38)
Location 22:36205836-36205858
Sequence TCTGTTCCTGTCTCAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173642_1183173645 -6 Left 1183173642 22:36205836-36205858 CCAGCTTTTGAGACAGGAACAGA No data
Right 1183173645 22:36205853-36205875 AACAGAAAGGTGATTACACAGGG No data
1183173642_1183173644 -7 Left 1183173642 22:36205836-36205858 CCAGCTTTTGAGACAGGAACAGA No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173642 Original CRISPR TCTGTTCCTGTCTCAAAAGC TGG (reversed) Intergenic