ID: 1183173644

View in Genome Browser
Species Human (GRCh38)
Location 22:36205852-36205874
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183173633_1183173644 19 Left 1183173633 22:36205810-36205832 CCTCCCCCCACCCATACGCACAC No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173640_1183173644 8 Left 1183173640 22:36205821-36205843 CCATACGCACACACACCAGCTTT No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173634_1183173644 16 Left 1183173634 22:36205813-36205835 CCCCCCACCCATACGCACACACA No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173635_1183173644 15 Left 1183173635 22:36205814-36205836 CCCCCACCCATACGCACACACAC No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173642_1183173644 -7 Left 1183173642 22:36205836-36205858 CCAGCTTTTGAGACAGGAACAGA No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173638_1183173644 12 Left 1183173638 22:36205817-36205839 CCACCCATACGCACACACACCAG No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173632_1183173644 22 Left 1183173632 22:36205807-36205829 CCACCTCCCCCCACCCATACGCA No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173639_1183173644 9 Left 1183173639 22:36205820-36205842 CCCATACGCACACACACCAGCTT No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173637_1183173644 13 Left 1183173637 22:36205816-36205838 CCCACCCATACGCACACACACCA No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data
1183173636_1183173644 14 Left 1183173636 22:36205815-36205837 CCCCACCCATACGCACACACACC No data
Right 1183173644 22:36205852-36205874 GAACAGAAAGGTGATTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183173644 Original CRISPR GAACAGAAAGGTGATTACAC AGG Intergenic