ID: 1183175514

View in Genome Browser
Species Human (GRCh38)
Location 22:36222240-36222262
Sequence CAGTGGTGCTTTGTTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183175514_1183175518 7 Left 1183175514 22:36222240-36222262 CCTGCTGTAACAAAGCACCACTG No data
Right 1183175518 22:36222270-36222292 GCCCACGCTCTCTTTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183175514 Original CRISPR CAGTGGTGCTTTGTTACAGC AGG (reversed) Intergenic