ID: 1183177286

View in Genome Browser
Species Human (GRCh38)
Location 22:36233283-36233305
Sequence TCCTGTGTACAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183177276_1183177286 26 Left 1183177276 22:36233234-36233256 CCTTAACCCTTGAGAACGAGAAA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 39
4: 335
1183177277_1183177286 20 Left 1183177277 22:36233240-36233262 CCCTTGAGAACGAGAAAACAAAT 0: 1
1: 0
2: 3
3: 25
4: 303
Right 1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 39
4: 335
1183177278_1183177286 19 Left 1183177278 22:36233241-36233263 CCTTGAGAACGAGAAAACAAATT 0: 1
1: 0
2: 5
3: 37
4: 374
Right 1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 39
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183177286 Original CRISPR TCCTGTGTACAGAGGGAGGC TGG Intronic
900333585 1:2149533-2149555 TCCTGTGTCTGGAGGGAGGCCGG + Intronic
900701872 1:4053583-4053605 TCAGGGGTTCAGAGGGAGGCTGG - Intergenic
900731384 1:4263673-4263695 ATCAGGGTACAGAGGGAGGCAGG + Intergenic
900782685 1:4628435-4628457 TCCTGTGTATCTGGGGAGGCCGG - Intergenic
901768598 1:11519295-11519317 TCCTGGGTACCCAGGGAGGGTGG - Intronic
902943864 1:19819886-19819908 TCCAGTGAACACAGGGAGCCAGG + Intergenic
904411242 1:30326157-30326179 TCCTCTGCACAGCTGGAGGCCGG + Intergenic
904873865 1:33638523-33638545 TCGTGTTTACACAAGGAGGCTGG - Intronic
904929517 1:34075260-34075282 TCTTGTGGGCAGAAGGAGGCTGG - Intronic
905243331 1:36595557-36595579 GCCTGTGTAGAGAGGAAGGAGGG + Intergenic
905286953 1:36887158-36887180 TTCTGTGTATGGTGGGAGGCAGG - Intronic
905370041 1:37478039-37478061 TCATGTGCCCGGAGGGAGGCAGG + Intronic
905866621 1:41380431-41380453 TTCTGAGGACAGAGGAAGGCAGG - Intronic
906128139 1:43440015-43440037 TCCTCTGTACATAGTGAAGCTGG - Exonic
906299619 1:44672630-44672652 TCATGCCAACAGAGGGAGGCAGG + Intronic
909384605 1:75040405-75040427 TGGAGTGTACAGAGGCAGGCAGG - Intergenic
909501976 1:76344935-76344957 TAGTGTGTGCAGAGGAAGGCTGG - Intronic
911611516 1:99963451-99963473 TCCTGTGTATAGAGGGCTGTAGG + Intergenic
912958512 1:114173958-114173980 TGCTGGGTAAAGAGGGAGGTGGG + Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
913580743 1:120224596-120224618 TGCAGTCTACAGAGGCAGGCAGG + Intergenic
913627436 1:120673803-120673825 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
914562673 1:148836033-148836055 TGCAGTCTACAGAGGCAGGCAGG + Intronic
914610156 1:149294189-149294211 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
915849566 1:159306715-159306737 GCCTGTGTATTGAGGGAGGAGGG + Intronic
916059021 1:161086404-161086426 TCCTGTTTACAGAGGGGGGCAGG - Intronic
916345682 1:163788661-163788683 TCCAGTCTACTGAGCGAGGCAGG - Intergenic
916534512 1:165690900-165690922 TGCAGTTTACAGAGGCAGGCAGG - Intronic
916737256 1:167618758-167618780 TGCTGGGTACTGAGGAAGGCCGG - Intergenic
917726795 1:177835608-177835630 TCATTTGTGCAGAGGGAGGTAGG + Intergenic
917795297 1:178528883-178528905 TCCTGTGTACAGAGCCATGGTGG + Intronic
918093002 1:181313696-181313718 TCCTGGGAGCAGACGGAGGCTGG - Intergenic
918761920 1:188420831-188420853 TCCTAAGTTCAAAGGGAGGCTGG + Intergenic
919065471 1:192688325-192688347 TGGTGTCTACAGAGGCAGGCAGG + Intergenic
921067334 1:211632236-211632258 GCCTGTGGACAGAGGAGGGCAGG + Intergenic
921839762 1:219815819-219815841 TCCTGTGTTTGGAGGGTGGCAGG + Intronic
922393171 1:225168692-225168714 TGCAGTCTACAGAGGCAGGCAGG - Intronic
922826668 1:228526286-228526308 TGGAGTGTACAGAGGCAGGCAGG + Intergenic
923207022 1:231768969-231768991 TCCTGTGTTCAGAGGGCAGCTGG + Intronic
923900788 1:238324021-238324043 GCCTGTGTACAGAGGAAAGGAGG - Intergenic
924285472 1:242481601-242481623 TGCAGTCTACAGAGGCAGGCAGG - Intronic
1063510707 10:6642743-6642765 TCCTGGATACAGAGCAAGGCAGG - Intergenic
1063971189 10:11382316-11382338 TCCTGTGGCCAGAGAGACGCTGG + Intergenic
1064102274 10:12474064-12474086 TTCTGGGTCCAGTGGGAGGCTGG + Intronic
1065606056 10:27418789-27418811 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1066176483 10:32912703-32912725 TGTTGTCTACAGAGGCAGGCAGG - Intronic
1067172548 10:43920375-43920397 TGGAGTGTACAGAGGCAGGCAGG + Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1067539123 10:47138846-47138868 TCCTGGAGACAGAGGGGGGCTGG + Intergenic
1068225075 10:54097815-54097837 TCCTGTTTTCACTGGGAGGCAGG + Intronic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1068576218 10:58687469-58687491 TGGAGTCTACAGAGGGAGGCAGG + Intronic
1068769908 10:60809558-60809580 TCCTGGGGACAAAGGTAGGCTGG + Intergenic
1069651148 10:70050330-70050352 TCCTTTTTACAGACTGAGGCAGG - Intergenic
1069996986 10:72348432-72348454 TCCTTAGCACAGAGGGATGCTGG - Intronic
1070819763 10:79347911-79347933 TCCAGTGCTCCGAGGGAGGCCGG - Intronic
1071763370 10:88634199-88634221 TGCAGTCTACAGAGGCAGGCAGG + Intergenic
1073782117 10:106850065-106850087 TGGAGTGTACAGAGGCAGGCAGG + Intronic
1073959669 10:108912090-108912112 TCCTTTGCACAGCGGGAGGGAGG - Intergenic
1074229569 10:111520358-111520380 TTCTGTGTGCATAGGGAGACAGG + Intergenic
1074247516 10:111709842-111709864 TCTTGTGTACAGAGGGGGATTGG - Intergenic
1074421286 10:113310811-113310833 TCATGGGAAGAGAGGGAGGCAGG - Intergenic
1074895676 10:117775707-117775729 TTCTCAGTACAAAGGGAGGCTGG - Intergenic
1075065298 10:119285322-119285344 TCCTGAGTACAGTGGGAGGGTGG + Intronic
1076631510 10:131854899-131854921 TGGTGTGGACAGAGAGAGGCTGG - Intergenic
1076685018 10:132194611-132194633 TTCTGTGCTCAGAGGGTGGCTGG + Intronic
1076720470 10:132390134-132390156 GCCTGTGTCCAGAGCGGGGCGGG - Intergenic
1076874877 10:133211086-133211108 CCATGGGTACCGAGGGAGGCTGG - Intronic
1076911530 10:133392441-133392463 TGCTGGCTACAGAGGGAGGCTGG - Intronic
1077308016 11:1876520-1876542 TCCTGAGCCCAGAGGGCGGCTGG - Intronic
1077488905 11:2851493-2851515 TCCTGAGTAGGGAGGGGGGCTGG - Intergenic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1077888458 11:6402782-6402804 TCCTGACTACAGAGTGTGGCAGG + Intronic
1078302664 11:10148682-10148704 TGTTTTGTACAGAGGGAGACAGG - Intronic
1078330712 11:10417060-10417082 TCCTGGGCACAGCTGGAGGCAGG - Intronic
1078434973 11:11316849-11316871 TCCTGTCTGGAGAGGGAGGCAGG - Intronic
1079161101 11:17995052-17995074 TGCTGTATACAGAGGGAGAAAGG + Intronic
1080275517 11:30499174-30499196 ACATGTGTACAGAAGGAGGGAGG + Intronic
1081741604 11:45444830-45444852 TCCTGTGGAGGGAGGGATGCTGG + Intergenic
1081768270 11:45628092-45628114 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1081789291 11:45771619-45771641 TCCTGTTTAGAGAGGAAGGTCGG + Exonic
1083002563 11:59308501-59308523 TTCTGAATACAGAGGGAGGTGGG + Intergenic
1083633693 11:64108924-64108946 TCCTAAGGACAGAGGCAGGCAGG + Intronic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1085174207 11:74472532-74472554 TCCTGTGCAGAGAGGGAAACAGG - Intergenic
1085308835 11:75504053-75504075 ACCTGTGCACAGAGAGGGGCAGG - Intronic
1086058464 11:82675841-82675863 TCCCATATAGAGAGGGAGGCAGG + Intergenic
1087007387 11:93483277-93483299 TCCTTAGCCCAGAGGGAGGCGGG - Intronic
1087103203 11:94384741-94384763 TGGAGTCTACAGAGGGAGGCAGG - Intronic
1092260585 12:6951528-6951550 TCCTGTCTACCGTGGGTGGCAGG - Intronic
1092638552 12:10478576-10478598 TGCAGTCTACAGAGGCAGGCAGG + Intergenic
1093717526 12:22400623-22400645 TGGTGTGTACAGAGGCAGGCAGG - Intronic
1095825598 12:46527418-46527440 TCCTGGGTACAGAGAGAGCTGGG + Intergenic
1095862617 12:46934837-46934859 ACCTATGTACAAAGGGAAGCAGG + Intergenic
1095986112 12:48000930-48000952 TGCTGTTTTCAGATGGAGGCAGG - Intronic
1096017094 12:48286503-48286525 TCCTGTCTAGAGAGGGAGTTGGG + Intergenic
1096456201 12:51789125-51789147 GCCAGTGTAGAGAAGGAGGCAGG + Intronic
1097155263 12:57007337-57007359 TCCTCTGTACTGAGGGAGGGAGG - Intergenic
1098595792 12:72272434-72272456 CCCGGTGTCCAGAGTGAGGCGGG + Intronic
1100625176 12:96324042-96324064 TCCTGTGTACTGGTGGAGGAAGG + Exonic
1101050285 12:100856014-100856036 TTCCCTGTACAAAGGGAGGCTGG + Intronic
1101175221 12:102143090-102143112 TGGAGTGTACAGAGGCAGGCGGG + Intronic
1102089743 12:110175971-110175993 TGGTGTGTAAAGAAGGAGGCTGG - Intronic
1102183499 12:110930878-110930900 TCCAGTGGACTGGGGGAGGCAGG + Intergenic
1102773659 12:115500183-115500205 TGCTGTGTTCAGAGGGAGCATGG + Intergenic
1105759742 13:23503106-23503128 TCCTGTGTGCAGAGTGGGTCTGG + Intergenic
1105874620 13:24541137-24541159 CCCTGAATTCAGAGGGAGGCTGG + Intergenic
1106117338 13:26829208-26829230 ACATGTGTACTGAGTGAGGCTGG + Intergenic
1107795297 13:44045684-44045706 ACCTGTGTAGAGCGGGAGCCAGG - Intergenic
1108569453 13:51735069-51735091 CCCTGTGTGCAGAGAGATGCAGG + Intronic
1114131453 14:19798207-19798229 TCCCCCATACAGAGGGAGGCGGG + Intronic
1115074881 14:29376324-29376346 TCATGGGTACTGAGGGAGGAAGG - Intergenic
1116111230 14:40586455-40586477 TTTTGTGTATAGAGTGAGGCAGG - Intergenic
1116711329 14:48371855-48371877 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1117969748 14:61240231-61240253 TCCCCTGTACAGAGGGAGGGAGG + Intronic
1119520453 14:75280762-75280784 TCCTGTATACAGAGGGATAAAGG - Exonic
1120865672 14:89293522-89293544 TGCTGTGTAAAGATGAAGGCAGG - Intronic
1121603963 14:95226987-95227009 TCCTGGGTACAGGGGAAGGCTGG + Intronic
1121664287 14:95660162-95660184 TCCTGTGTCCAGAGGAACCCTGG - Intergenic
1125087550 15:35748094-35748116 TCCTCTGTACAGAGGCAGGGGGG + Intergenic
1125750689 15:42025630-42025652 GCTTGGGTACAGAGGGAGGTAGG - Intronic
1127961755 15:63895456-63895478 TCCTGTGTTCCGAGGGATGGGGG - Intergenic
1128242190 15:66108672-66108694 TCCTGTGTACAGGAGGAGCCAGG + Intronic
1129701997 15:77773566-77773588 TCCTGTGTGGAGAGGGAGCTGGG - Intronic
1130044849 15:80435610-80435632 TCCTGTGGACAGAGGGAGGGAGG - Intronic
1131533861 15:93217410-93217432 TCCTGGGTCCTGAGGGAAGCTGG + Intergenic
1131595377 15:93792758-93792780 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1132379586 15:101357551-101357573 TATTGTGTACACAGGGAGGCAGG - Intronic
1132486879 16:197825-197847 TCAGGTATACAGGGGGAGGCTGG + Intronic
1132623640 16:879825-879847 TCCTGTGTGCAGTAGGAGCCGGG - Intronic
1132841774 16:1981513-1981535 TCCTGTGGCCAGAGGCAGGCAGG - Exonic
1135481835 16:22827170-22827192 CCCTGAGGACAGAGGGTGGCTGG + Intronic
1136991020 16:35151445-35151467 GCCAGTGTACAGGGAGAGGCAGG - Intergenic
1138583352 16:57955734-57955756 GGCTGTGTAGAGACGGAGGCGGG + Intronic
1140069209 16:71634599-71634621 TCCTGTGTGTAAAGAGAGGCAGG + Intronic
1142906923 17:3049540-3049562 TCCTGTTTACTGTGGGATGCGGG - Intergenic
1142921388 17:3190150-3190172 GCTTGGGCACAGAGGGAGGCGGG - Intergenic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1143197368 17:5086319-5086341 TCCTGTGGATAACGGGAGGCTGG + Intronic
1143854917 17:9841472-9841494 TTCTGGGTACAGATGAAGGCAGG + Intronic
1145782180 17:27570622-27570644 TGCTTTGTGGAGAGGGAGGCAGG + Intronic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1147167145 17:38599660-38599682 TCCTATGCAGAGATGGAGGCAGG + Intronic
1147963973 17:44183491-44183513 TCCTCCCTAGAGAGGGAGGCTGG + Intergenic
1149202157 17:54199430-54199452 TCCAGTGGACAGAGGGAGAATGG - Intergenic
1150584898 17:66508589-66508611 TCCTGTGTGCAGAGGACAGCTGG - Intronic
1151280272 17:73068819-73068841 GCGTGTGCACAGGGGGAGGCTGG - Intronic
1151323801 17:73366788-73366810 GCCTGTGTGCAGAGCGAGCCTGG - Intronic
1151855538 17:76718850-76718872 TCCTGTGTCCAGTGCGAGTCTGG - Exonic
1152257127 17:79246629-79246651 GCCTGTGAACATAGGCAGGCTGG - Intronic
1153221439 18:2865809-2865831 TGCAGTCTACAGAGGCAGGCAGG + Intronic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1154217954 18:12429290-12429312 TGCTGTCTGCAGCGGGAGGCGGG + Intronic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1154331882 18:13436763-13436785 ATCTGTGTGCAGAGTGAGGCTGG - Intronic
1154364096 18:13690295-13690317 TGGTGTCTACAGAGGCAGGCAGG - Intronic
1155934393 18:31740187-31740209 TCCCCTGTACAGAGGGAGGGGGG + Intergenic
1155934962 18:31744317-31744339 TCCCCTGTACAGAGGGAAGGGGG + Intergenic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1157337458 18:46752041-46752063 TGCTGGGGACAGAGTGAGGCAGG - Intronic
1157752229 18:50189500-50189522 GCCTGTGTGCATAGGGAGCCTGG - Intronic
1158791613 18:60786310-60786332 TCCTGTGGATAGTGGAAGGCTGG - Intergenic
1159627809 18:70714834-70714856 TGGAGTGTACAGAGGCAGGCAGG - Intergenic
1159982144 18:74795931-74795953 GCGTGTGCACAGCGGGAGGCTGG - Intronic
1160710337 19:548521-548543 TCCTGGGGACAGAGGGAATCAGG - Exonic
1161096751 19:2396535-2396557 CCCTGTGTAGAGAGGAAGGCTGG - Exonic
1161298933 19:3533473-3533495 TCCTGTGTTCTTAGGGAGGATGG + Intronic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1161981891 19:7634187-7634209 CCCTGGGGACAGAGGCAGGCGGG + Intronic
1162478773 19:10915996-10916018 TGCTCTGGACAGAGGGAGGGTGG - Intronic
1162851966 19:13437885-13437907 CCCAGTGGACAGAGGGAGCCAGG + Intronic
1163404192 19:17112403-17112425 GCCAGTGGCCAGAGGGAGGCTGG + Intronic
1164719462 19:30421807-30421829 TCTCGTGTACAGAGGGAGGCTGG - Intronic
1165106586 19:33473411-33473433 TCCTGTGCACACAGAGAGGCCGG + Intronic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1165454208 19:35901252-35901274 TACTGGGTCCAGAGGGAGGCAGG + Intronic
1166301483 19:41914072-41914094 TCCAGTGTCCAGGGGTAGGCGGG - Intronic
1166546055 19:43635483-43635505 TCCTGGGTCCTGAGGGAGGAAGG - Intronic
1166987607 19:46670915-46670937 TGCTGTGTACTGAGGTAGGGAGG + Intergenic
1167378641 19:49125831-49125853 TCCTGTGACCTGAGGGAGGCGGG + Intronic
1167851332 19:52204680-52204702 AACTGTGTGCAGAGGGAGCCAGG + Intronic
1167872314 19:52381244-52381266 TCCTAAGTACAGAATGAGGCTGG - Intronic
925206338 2:2010203-2010225 TTCTGTGTAGAGAGTGAGGAAGG + Intronic
926441310 2:12891529-12891551 TGCTGTATACAGAGAGAGGAAGG + Intergenic
926997748 2:18756590-18756612 TCCTGTGTATAGTGGGATGGTGG + Intergenic
927478267 2:23430675-23430697 TCCTGTGGGCTGAGGTAGGCAGG - Intronic
928708648 2:33979763-33979785 TCCATTGTACAGGGGGAGGTGGG + Intergenic
929863346 2:45697674-45697696 TCCTGGGAACAGAGGCAGGTTGG - Intronic
929996076 2:46826982-46827004 TGCAGTGTACAGAGAGGGGCAGG - Intronic
930308533 2:49708147-49708169 TTCTGTATACAGTGTGAGGCAGG - Intergenic
930358436 2:50347857-50347879 GCCTATGTAACGAGGGAGGCTGG + Intronic
930547201 2:52783358-52783380 TCCTGTGTAGAGAGAGATGATGG - Intergenic
930588149 2:53294497-53294519 TCCTGGTGACAGAGGGAGGGAGG + Intergenic
932276191 2:70453958-70453980 TCCTGCCCACAGAGGGAGGCAGG - Intronic
935369004 2:102324893-102324915 TGCAGTCTACAGAGGCAGGCAGG - Intronic
938799895 2:134752116-134752138 TGGTGTCTACAGAGGTAGGCTGG + Intergenic
939055577 2:137360744-137360766 TGGGGTGTACAGAGGCAGGCAGG - Intronic
944647357 2:201792996-201793018 TCCTGTGAACACAGGTAGGTAGG + Intronic
945721491 2:213422664-213422686 TTGTGTGTACAGAGGGTGGGAGG - Intronic
946170531 2:217892764-217892786 GCCTGTGGACAGAGGGCGGGAGG - Intronic
946189612 2:218001540-218001562 TGCTGAGGACAGAGGTAGGCAGG - Intronic
946554103 2:220835820-220835842 TCATGGGTACAGTGGGAGGCTGG - Intergenic
947267523 2:228299960-228299982 TCCCCTGTACAGAGGGAGGGGGG + Intergenic
948227593 2:236323531-236323553 TGCTGTGTACAGACACAGGCTGG + Intergenic
1169263425 20:4153654-4153676 TCCTAGGAAGAGAGGGAGGCAGG + Intronic
1169335298 20:4750917-4750939 GCCTGTGTCCACAGGGAGGATGG + Intergenic
1169551023 20:6701305-6701327 TCCTGAGCCCAGAGGGAGGCAGG + Intergenic
1171143519 20:22763072-22763094 TCCTGAGCACAGAGGAATGCAGG - Intergenic
1172470727 20:35192672-35192694 GCTTGGGTACAGAGGGAGGTGGG - Intergenic
1172480632 20:35269400-35269422 TCCTCGGGACAGTGGGAGGCTGG - Intronic
1172977730 20:38919267-38919289 CGCTGTGTTCAGAGGGAGCCAGG + Exonic
1174064165 20:47852746-47852768 CCCTGTCTACAGAGGGAGGAGGG + Intergenic
1175345692 20:58272994-58273016 ACCTGTGTCCAGAAGGAGGACGG + Intergenic
1176051569 20:63122474-63122496 TACAGTGGAAAGAGGGAGGCGGG - Intergenic
1179106325 21:38403827-38403849 TCCTGGGTAGCCAGGGAGGCTGG - Intronic
1180082393 21:45492945-45492967 TGCAGTGTCCAGAGTGAGGCTGG + Intronic
1180082412 21:45493007-45493029 TGCAGTGTCCAGAGTGAGGCTGG + Intronic
1180148746 21:45936817-45936839 TCCTTTGTACAGATGGATGCTGG + Intronic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1183121199 22:35731523-35731545 TGCCGGGAACAGAGGGAGGCGGG + Intergenic
1183166253 22:36149184-36149206 ACCTGTGGACAGAGGGAGGTTGG + Intronic
1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG + Intronic
1183319430 22:37156059-37156081 TCCAGTGAGCAGAGGGAGGACGG - Intronic
1183367982 22:37417315-37417337 TCCATTGTAGAGAGAGAGGCTGG - Intronic
1183926651 22:41211140-41211162 GCCTGTGAAGAGAGGCAGGCTGG + Intronic
1184764536 22:46564577-46564599 TCCTGAGCAGAGAGGGGGGCAGG + Intergenic
1185142151 22:49108528-49108550 ACCTGTGTGCAGATGGAGGGGGG + Intergenic
1185161664 22:49233666-49233688 TCCTCTGAGCAGAGGGAGGTGGG + Intergenic
949209226 3:1478009-1478031 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
949478684 3:4472665-4472687 ACCTGTGGAAGGAGGGAGGCAGG + Intergenic
949571803 3:5300866-5300888 TCTTGTGTACAGCGAGAGTCTGG + Intergenic
949918877 3:8985931-8985953 TCCTGGGGACAGAGGGAGCTGGG + Exonic
951684506 3:25329065-25329087 TGCAGTTTACAGAGGCAGGCAGG - Intronic
954300759 3:49699647-49699669 TCCTGTGTGGAGGGGGAGGAGGG - Exonic
954539216 3:51382622-51382644 TCCTGGGTAAAGAGGGTGGGAGG + Exonic
955411659 3:58659381-58659403 CCCTGTGTACAGAAGGCCGCAGG - Intronic
955999873 3:64717915-64717937 TCCTATCTACAAAGGGAGGCAGG - Intergenic
956022251 3:64945360-64945382 TCCTGTACACAGAGAGAAGCAGG + Intergenic
959736494 3:109665247-109665269 TGCAGTCTACAGAGGCAGGCGGG - Intergenic
959906008 3:111712133-111712155 TTCTGTTTACAGGGGGAGGCCGG - Intronic
960811302 3:121629917-121629939 GACTGTGTACACAGGGAGGGAGG + Exonic
960974539 3:123161654-123161676 TCCTGTCCCCAGAGGCAGGCTGG + Intronic
961182271 3:124886676-124886698 TCCTGTGTAAACAGGCTGGCCGG - Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961335934 3:126179878-126179900 TCGCGCGTGCAGAGGGAGGCCGG - Intronic
961646818 3:128397184-128397206 TCCTGTGGAAGGAGGGAGGATGG - Intronic
963045907 3:141102579-141102601 CCCTGTGGCAAGAGGGAGGCTGG + Intronic
965827508 3:172745641-172745663 TCATGCAGACAGAGGGAGGCAGG + Intergenic
966119409 3:176505927-176505949 TCCCTTGTACAGAGGGAGGAGGG + Intergenic
967194958 3:187018058-187018080 TGCTGTGTCCCGGGGGAGGCAGG + Intronic
967875687 3:194267101-194267123 TTCTCTGTCCAGAGTGAGGCAGG - Intergenic
967995741 3:195165037-195165059 TCATGTGTACACAGGAAGGCGGG - Intronic
969122324 4:4919524-4919546 TCCCGTCTGCACAGGGAGGCAGG - Intergenic
969702046 4:8773161-8773183 TCCTGAGAGCAGAGAGAGGCGGG + Intergenic
970091596 4:12414490-12414512 TCTTGTGTGCAGAGGAATGCAGG + Intergenic
970968983 4:21959628-21959650 TCCTCTGTACAGAATGAGGAAGG + Intergenic
971412754 4:26392650-26392672 TCCTGGGGATAGGGGGAGGCAGG + Intronic
972347195 4:38202351-38202373 TCCAGTGTACAAAAGGAGGAAGG + Intergenic
973208521 4:47587908-47587930 TCCTGTATACAGGGGCAAGCAGG - Intronic
974155943 4:58072657-58072679 AGCTGTGTACACAAGGAGGCCGG + Intergenic
978102136 4:104854517-104854539 ACCTGTGGAAAGAGAGAGGCAGG - Intergenic
978658951 4:111100239-111100261 TGGTGTCTACAGAGGCAGGCAGG + Intergenic
978773292 4:112480170-112480192 TGGAGTGTACAGAGGCAGGCCGG + Intergenic
985732176 5:1555524-1555546 TGGTGTTTGCAGAGGGAGGCAGG - Intergenic
986286247 5:6361063-6361085 TCCTTAGAACAGAGGCAGGCAGG - Intergenic
986300179 5:6472258-6472280 TCCTGTGACCACAGGGAGGTGGG - Intronic
992089572 5:73304954-73304976 TCTTGAGTACAGAGGGAGGCAGG + Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
996575939 5:124976490-124976512 TCCTGCAAGCAGAGGGAGGCTGG + Intergenic
997797824 5:136828611-136828633 TAGAGTGTACAGAGGCAGGCAGG + Intergenic
999694150 5:154173408-154173430 TCCTGTGTTCAGAGGAAGGATGG - Intronic
1000647949 5:163781153-163781175 TGGAGTGTACAGAGGCAGGCAGG - Intergenic
1002212171 5:177605560-177605582 CCCTGTGCACAGAGGCTGGCAGG - Intronic
1002443168 5:179274738-179274760 TCAAGTGTAGCGAGGGAGGCTGG + Intronic
1002858838 6:1061903-1061925 TGCTGAGGACAGAGGGAGTCAGG - Intergenic
1002911152 6:1491734-1491756 TCCTGTGCTCAGACAGAGGCCGG - Intergenic
1003408944 6:5846546-5846568 GCCTGTGTACAGAGAGAGTGGGG + Intergenic
1003796701 6:9613264-9613286 TGCTGTGTGCACAGGGAGGGTGG - Intronic
1005849546 6:29811413-29811435 CCCTGTGAACACAGGGAGTCAGG + Intergenic
1005861384 6:29905344-29905366 CCCTGTGAACACAGGCAGGCAGG + Intergenic
1006349480 6:33510463-33510485 TCCTGTGTCGGGAGGGTGGCAGG + Intergenic
1006397582 6:33797127-33797149 GCCTGTGTCCAGTGGGAGGTGGG + Intronic
1007124251 6:39411588-39411610 TATTGTGTGCAGAAGGAGGCTGG + Intronic
1007193673 6:40040843-40040865 TCCTGTGTGCAGAGCAAGACAGG - Intergenic
1007597498 6:43060394-43060416 ACCTGTGGGCAGAGGGAGGGAGG + Intronic
1007922959 6:45627231-45627253 CCGTGTGTACAGAGGAAGGCTGG - Intronic
1008281279 6:49599084-49599106 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1009628689 6:66167008-66167030 TGCAGTCTACAGAGGCAGGCGGG - Intergenic
1011798608 6:90983817-90983839 GGCTGTGTGAAGAGGGAGGCAGG - Intergenic
1015954176 6:138583115-138583137 TCCTGGGTACAAAGGATGGCTGG + Intronic
1015973905 6:138769891-138769913 TCCAGTCTACAGCTGGAGGCTGG + Intronic
1016385261 6:143524625-143524647 TCCAAAGTAGAGAGGGAGGCAGG - Intergenic
1018698429 6:166408313-166408335 TTCTGGGTACAGCAGGAGGCAGG + Intergenic
1019067977 6:169318476-169318498 TCCCTTGTCCAGAGAGAGGCTGG + Intergenic
1019281435 7:202393-202415 TCCTGTGTGCATAGAGAGGACGG + Intronic
1019281542 7:202831-202853 TCCTGTGTGCATAGCGAGGACGG + Intronic
1019576788 7:1741441-1741463 GCCTGTGTGATGAGGGAGGCAGG - Intronic
1019710794 7:2517375-2517397 TCCTGGCTACAGAGAGACGCGGG + Intronic
1020773389 7:12424085-12424107 TCCCCTGTACAGAGGGATGAGGG + Intergenic
1021536767 7:21713962-21713984 TTCTCTGTACAGAGGGAGTCAGG - Intronic
1022671901 7:32463560-32463582 TCCTGTGAATAGAGAAAGGCAGG + Intergenic
1024056449 7:45662643-45662665 TCCTGCATAGAGAGGGAGCCAGG - Intronic
1024359975 7:48458283-48458305 GCCTGTGTACACAGGGAGTCAGG - Intronic
1024460054 7:49650265-49650287 TGGAGTGTACAGAGGCAGGCAGG - Intergenic
1024787290 7:52922734-52922756 TCAGGTGTACAGAGGGGGCCAGG + Intergenic
1024891105 7:54204525-54204547 TGCTGTGTACAAGAGGAGGCTGG - Intergenic
1028446415 7:90928822-90928844 TGGAGTGTACAGAGGCAGGCAGG + Intronic
1029489638 7:100863487-100863509 ACCAGTGTTCAGAGGAAGGCAGG + Intronic
1029982699 7:104894014-104894036 TGCTGTGCACAGATGGAGACTGG - Intronic
1031572519 7:123376672-123376694 TCCTGGTTACTGAGGGAGGTTGG + Intergenic
1032440959 7:131942886-131942908 TCCTGTGATAAGAGGGAGGGTGG + Intergenic
1032621025 7:133532401-133532423 TCCTGTTTACAGTGGGAGAGTGG - Intronic
1033207370 7:139434495-139434517 TACTGCTTACAGAGGGAGGGAGG - Intergenic
1034950232 7:155291815-155291837 TCCTGAGTTAAGAGGGAGACAGG - Intergenic
1035274657 7:157740514-157740536 CCCCGTGGACAGAGGGAGACAGG - Intronic
1036008938 8:4698680-4698702 TCCCCCGTACAGAGGGAGGAGGG - Intronic
1036570912 8:9979260-9979282 TCCTGTCTAGTGAGGGAGACTGG - Intergenic
1036655104 8:10672757-10672779 TCCTGGGCACATAGGGAGGTGGG + Intronic
1036911750 8:12763350-12763372 TCCTGTTTATAGAGGGTGCCTGG + Intergenic
1037615845 8:20518420-20518442 CCCTGTGAAAAGAAGGAGGCAGG + Intergenic
1039348798 8:36738237-36738259 TAATGTTTATAGAGGGAGGCAGG + Intergenic
1040093659 8:43421725-43421747 TTATGTGTGCAGAGGTAGGCTGG + Intergenic
1041665897 8:60444586-60444608 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1042171713 8:65998379-65998401 TGGTGTCTACAGAGGCAGGCAGG + Intergenic
1042414931 8:68508614-68508636 TCATGTGTCCAGAGGTTGGCTGG + Intronic
1044272593 8:90264633-90264655 TGGTGTCTACAGAGGCAGGCAGG - Intergenic
1045296276 8:100874131-100874153 TCCTGTCTGCAGAGAGAAGCAGG - Intergenic
1047105759 8:121728584-121728606 TACTCTGGACAGAGAGAGGCAGG + Intergenic
1047170898 8:122491299-122491321 ACCTGTGCACCGAGGGAGGTGGG + Intergenic
1047495430 8:125405433-125405455 TCCTGAGGACAGAGGGAGCGAGG + Intergenic
1048191951 8:132298113-132298135 TCCTGTCTACAGGGGGATGCTGG + Intronic
1049339820 8:142106073-142106095 TCCTGTGGACAGAGAGACACAGG + Intergenic
1050329546 9:4531598-4531620 TGGAGTGTACAGAGGCAGGCAGG - Intronic
1053062904 9:35045336-35045358 CCATGTGTACACATGGAGGCTGG + Exonic
1053268172 9:36731156-36731178 TCCTGGGCAGAGAGGGAGGGTGG - Intergenic
1053582994 9:39426156-39426178 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1053847174 9:42251017-42251039 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1054104573 9:60984899-60984921 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1054581769 9:66921950-66921972 TGCAGTCTACAGAGGCAGGCAGG + Intronic
1055481163 9:76710376-76710398 TCTTCTGTATAGAGTGAGGCTGG + Exonic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1055617114 9:78084115-78084137 TGGAGTGTACAGAGGCAGGCAGG - Intergenic
1057275390 9:93673592-93673614 TCCTGTGTGCTGGGGGAGGCCGG - Exonic
1058207913 9:102131346-102131368 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1059330042 9:113529092-113529114 TCCTGGGAAAAGAGAGAGGCAGG - Intronic
1059736708 9:117107658-117107680 TCTTGTGTTCAGAGAGAGGGAGG - Intronic
1060196576 9:121627999-121628021 TCCTGCAGACAGAGGGATGCTGG - Intronic
1060940417 9:127540213-127540235 TCCTGTGCAGATAGTGAGGCTGG + Intronic
1061456419 9:130701272-130701294 TCCTGGGAACAAAGGCAGGCTGG + Intronic
1061695052 9:132367157-132367179 TCTGGTGTTCAGAGGGAGGTCGG + Intergenic
1061951416 9:133938398-133938420 GCCTGGGTACAGAGGGACGCAGG - Intronic
1062138548 9:134942936-134942958 GTCTGTGTTCTGAGGGAGGCTGG - Intergenic
1062416199 9:136451527-136451549 TCTGGTGACCAGAGGGAGGCAGG + Intronic
1062468721 9:136692748-136692770 TCCTGTGGGCAGAGGCAGGCGGG + Intergenic
1062524484 9:136972730-136972752 TCCTCAGGACAGAGGGTGGCCGG - Intergenic
1185488471 X:500581-500603 TCCTGCGTACAGAGGCAGAGGGG - Intergenic
1186066836 X:5775462-5775484 TTCTGTCTAGAGAGAGAGGCAGG + Intergenic
1186171606 X:6882936-6882958 TCCTGTGGACAGAGGGTGTTGGG + Intergenic
1186961614 X:14742964-14742986 TCCTGTGAACACAGGGATGGCGG + Intergenic
1187672476 X:21682167-21682189 TCCAGGGTAATGAGGGAGGCTGG + Intergenic
1189465908 X:41277235-41277257 TCCTGTGTAAACAGGGGAGCTGG + Intergenic
1189590107 X:42501977-42501999 TCCTGTGGAAAGAGAGAGGAAGG + Intergenic
1189664174 X:43335001-43335023 CCCAGGGTACAGAGGCAGGCAGG - Intergenic
1190462085 X:50686893-50686915 TCTTGTGAACAGAAGGAAGCAGG + Intronic
1190732962 X:53236599-53236621 GCCTGGGGACAGAGGGAGGGAGG - Intronic
1191587025 X:62838904-62838926 TCATGGGTACAGAGCGAGGAGGG - Intergenic
1193541320 X:82775728-82775750 TCCAGAGTACAGATGCAGGCAGG - Intergenic
1194104917 X:89757129-89757151 TTCCCTGTACAGAGGGAGGGAGG + Intergenic
1196853590 X:119961995-119962017 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1196944690 X:120812045-120812067 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1198165311 X:134049760-134049782 TGCAGTCTACAGAGGCAGGCAGG + Intergenic
1198172168 X:134117706-134117728 TGCAGTCTACAGAGGCAGGCAGG - Intergenic
1200456883 Y:3404918-3404940 TTCCCTGTACAGAGGGAGGGAGG + Intergenic
1200805428 Y:7428510-7428532 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1201567735 Y:15384378-15384400 CCCTGTGGACAGTGAGAGGCTGG + Intergenic
1201992422 Y:20042457-20042479 TGGTGTCTACAGAGGCAGGCAGG + Intergenic