ID: 1183179349

View in Genome Browser
Species Human (GRCh38)
Location 22:36248278-36248300
Sequence TTTTCCTGGGGCCAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183179349_1183179355 20 Left 1183179349 22:36248278-36248300 CCACAAAACTGGCCCCAGGAAAA No data
Right 1183179355 22:36248321-36248343 GAGATTGTGAGGGCCATTCAAGG No data
1183179349_1183179353 9 Left 1183179349 22:36248278-36248300 CCACAAAACTGGCCCCAGGAAAA No data
Right 1183179353 22:36248310-36248332 AACAGTGTGATGAGATTGTGAGG No data
1183179349_1183179357 30 Left 1183179349 22:36248278-36248300 CCACAAAACTGGCCCCAGGAAAA No data
Right 1183179357 22:36248331-36248353 GGGCCATTCAAGGCTATGCAGGG No data
1183179349_1183179356 29 Left 1183179349 22:36248278-36248300 CCACAAAACTGGCCCCAGGAAAA No data
Right 1183179356 22:36248330-36248352 AGGGCCATTCAAGGCTATGCAGG No data
1183179349_1183179354 10 Left 1183179349 22:36248278-36248300 CCACAAAACTGGCCCCAGGAAAA No data
Right 1183179354 22:36248311-36248333 ACAGTGTGATGAGATTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183179349 Original CRISPR TTTTCCTGGGGCCAGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr