ID: 1183179351

View in Genome Browser
Species Human (GRCh38)
Location 22:36248291-36248313
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183179351_1183179358 18 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179358 22:36248332-36248354 GGCCATTCAAGGCTATGCAGGGG No data
1183179351_1183179356 16 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179356 22:36248330-36248352 AGGGCCATTCAAGGCTATGCAGG No data
1183179351_1183179353 -4 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179353 22:36248310-36248332 AACAGTGTGATGAGATTGTGAGG No data
1183179351_1183179360 23 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179360 22:36248337-36248359 TTCAAGGCTATGCAGGGGTGTGG No data
1183179351_1183179357 17 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179357 22:36248331-36248353 GGGCCATTCAAGGCTATGCAGGG No data
1183179351_1183179355 7 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179355 22:36248321-36248343 GAGATTGTGAGGGCCATTCAAGG No data
1183179351_1183179354 -3 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179354 22:36248311-36248333 ACAGTGTGATGAGATTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183179351 Original CRISPR TGTTTTTCTGTGATTTTCCT GGG (reversed) Intergenic
No off target data available for this crispr