ID: 1183179360

View in Genome Browser
Species Human (GRCh38)
Location 22:36248337-36248359
Sequence TTCAAGGCTATGCAGGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183179351_1183179360 23 Left 1183179351 22:36248291-36248313 CCCAGGAAAATCACAGAAAAACA No data
Right 1183179360 22:36248337-36248359 TTCAAGGCTATGCAGGGGTGTGG No data
1183179352_1183179360 22 Left 1183179352 22:36248292-36248314 CCAGGAAAATCACAGAAAAACAG No data
Right 1183179360 22:36248337-36248359 TTCAAGGCTATGCAGGGGTGTGG No data
1183179350_1183179360 24 Left 1183179350 22:36248290-36248312 CCCCAGGAAAATCACAGAAAAAC No data
Right 1183179360 22:36248337-36248359 TTCAAGGCTATGCAGGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183179360 Original CRISPR TTCAAGGCTATGCAGGGGTG TGG Intergenic
No off target data available for this crispr