ID: 1183180048

View in Genome Browser
Species Human (GRCh38)
Location 22:36253819-36253841
Sequence AAGTCTGAACAGAGGGACAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 2, 2: 2, 3: 17, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183180048_1183180055 1 Left 1183180048 22:36253819-36253841 CCTCTGTCCCTCTGTTCAGACTT 0: 1
1: 2
2: 2
3: 17
4: 281
Right 1183180055 22:36253843-36253865 TGGGGTGATGGAGAAGAAACAGG 0: 2
1: 0
2: 3
3: 49
4: 446
1183180048_1183180056 21 Left 1183180048 22:36253819-36253841 CCTCTGTCCCTCTGTTCAGACTT 0: 1
1: 2
2: 2
3: 17
4: 281
Right 1183180056 22:36253863-36253885 AGGCTGTGCTGTGTCCCTAATGG 0: 3
1: 0
2: 2
3: 34
4: 173
1183180048_1183180058 30 Left 1183180048 22:36253819-36253841 CCTCTGTCCCTCTGTTCAGACTT 0: 1
1: 2
2: 2
3: 17
4: 281
Right 1183180058 22:36253872-36253894 TGTGTCCCTAATGGGAAACGTGG 0: 1
1: 1
2: 0
3: 9
4: 111
1183180048_1183180057 22 Left 1183180048 22:36253819-36253841 CCTCTGTCCCTCTGTTCAGACTT 0: 1
1: 2
2: 2
3: 17
4: 281
Right 1183180057 22:36253864-36253886 GGCTGTGCTGTGTCCCTAATGGG 0: 3
1: 0
2: 2
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183180048 Original CRISPR AAGTCTGAACAGAGGGACAG AGG (reversed) Exonic
901636041 1:10670624-10670646 AAGTCTGAACTGAGGATCCGCGG - Intronic
903625141 1:24725041-24725063 AAGCCTGAGAAGAGGGTCAGAGG + Intergenic
903682782 1:25108276-25108298 AAGTCTGGGGACAGGGACAGTGG + Intergenic
905060838 1:35137696-35137718 GAGTCTGAAAAGAGAGTCAGTGG + Intergenic
905872960 1:41415521-41415543 AAAACAGAACAGAGGGACAAGGG + Intergenic
906224032 1:44106266-44106288 GAGGATGGACAGAGGGACAGAGG - Intergenic
906685207 1:47758749-47758771 GAGTCTGATGAGTGGGACAGAGG + Intergenic
907403723 1:54241138-54241160 TGGTCTGAAGAAAGGGACAGGGG - Intronic
908213065 1:61921335-61921357 AAATCTGAACTGAAAGACAGTGG - Intronic
912897466 1:113608202-113608224 ATGTTTGAAAAGAGGGAAAGAGG + Intronic
913130075 1:115831003-115831025 CAGTCTGCCAAGAGGGACAGAGG + Intergenic
914906377 1:151749450-151749472 GAGTGTCAACAGAGGTACAGTGG - Intergenic
915758775 1:158289975-158289997 AAGTCAGAATATAGGTACAGAGG + Exonic
916505529 1:165425097-165425119 ATGTCTGTACAGAGGGATTGGGG - Intronic
916851350 1:168707521-168707543 AAGTTTGAACATAAGGAGAGAGG + Intronic
917007843 1:170435264-170435286 AAGTCTGAGAAGAGGTAGAGAGG + Intergenic
917282455 1:173391556-173391578 AAGTATGAACAGGGTCACAGTGG - Intergenic
917455058 1:175179095-175179117 AAGCCAGAGCAGAGGTACAGAGG + Intronic
918465795 1:184820353-184820375 AAGTAGGCACAGAGGGAGAGTGG - Intronic
919138197 1:193537011-193537033 AACTCTGAAGAGAGGGACAAAGG + Intergenic
920157838 1:203969878-203969900 CAGTCTGCACAGAGAGAGAGAGG + Intergenic
920382203 1:205541690-205541712 AAGTCCAAACAGAGGGAACGTGG - Intergenic
921102627 1:211943587-211943609 AAGTCAAAACAGAGGAAAAGAGG + Intronic
924261523 1:242236287-242236309 CAGCCTGAACAGACTGACAGTGG + Intronic
924525763 1:244846544-244846566 AAGTCTGGATAGAGGGGAAGGGG - Intronic
924732832 1:246727769-246727791 AAGACTGAAGAGTGTGACAGAGG + Intronic
924771017 1:247079431-247079453 GAGTCCGAAAAGAGGGTCAGCGG + Intergenic
1063988992 10:11539141-11539163 AAGGCTGCACCCAGGGACAGGGG - Intronic
1069951054 10:72018344-72018366 AAAGCTCAACAGAGTGACAGAGG + Intergenic
1071432178 10:85614859-85614881 AAGTCTTAACAGAGAGCCAGTGG + Intronic
1073483397 10:103801149-103801171 AGGTGGGAGCAGAGGGACAGAGG - Intronic
1073809677 10:107138832-107138854 CAGTCTGCAGTGAGGGACAGCGG - Intronic
1073915019 10:108392660-108392682 TAGGCTGAAGAGAGGGACAAGGG + Intergenic
1074607287 10:114985844-114985866 AGGTCTGAAGAGAGGGAGAGAGG + Intergenic
1074781991 10:116808844-116808866 AAGTCTGAACATAGGAACGGCGG - Intergenic
1075579635 10:123607261-123607283 AAATCTTGACAGAGGGTCAGGGG - Intergenic
1076464120 10:130666679-130666701 CAGGCTGAAAAGAGGGAAAGAGG + Intergenic
1077490627 11:2859340-2859362 AGGTGTAAAGAGAGGGACAGAGG + Intergenic
1078735772 11:14019250-14019272 AAAACTGAACTGAGGCACAGAGG - Intronic
1078860516 11:15242517-15242539 AGGGCCGAACAGATGGACAGTGG - Intronic
1079587076 11:22139433-22139455 AAGTAGGAAGAGAGGGAGAGAGG - Intergenic
1081491046 11:43569181-43569203 AAATCTACACAGTGGGACAGTGG + Intronic
1082780905 11:57286880-57286902 AAGTCTGGGCAGAAGGGCAGAGG - Intergenic
1083299691 11:61733916-61733938 ACGTTTGAACAGAGGCCCAGAGG + Intronic
1083331662 11:61901264-61901286 AAGAGTCAACAGAGGGACAGAGG + Intronic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1085154096 11:74277434-74277456 ACATCTGAACAGAGGGACCCGGG + Intronic
1086817749 11:91394242-91394264 CCGTATGAACAGAGGGTCAGAGG - Intergenic
1086919433 11:92569450-92569472 AAGCCTGATGAGGGGGACAGAGG + Intronic
1087648393 11:100834746-100834768 AGGTATGAACAGAGGGATGGAGG + Intronic
1087657455 11:100941625-100941647 GAGAAAGAACAGAGGGACAGCGG - Intronic
1088352150 11:108901695-108901717 AATTCTGAAAAGAGCCACAGAGG - Intronic
1088355730 11:108942071-108942093 ATGTGAGAGCAGAGGGACAGTGG - Intergenic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1090047634 11:123350204-123350226 ATGTCTGGAGGGAGGGACAGAGG + Intergenic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1091288462 11:134422694-134422716 AATTCTGCACATAGGGCCAGGGG - Intergenic
1091318977 11:134636367-134636389 AAGTCTGAAAGGAGGCAGAGAGG - Intergenic
1091821882 12:3481477-3481499 AACTCTGAACACAGGGAGTGGGG + Intronic
1092024635 12:5230571-5230593 AAGCCTGAAATGAGGGAGAGAGG - Intergenic
1093575159 12:20719279-20719301 AAGTCCAAAAAGAGAGACAGGGG - Intronic
1093780644 12:23132896-23132918 AAGTCTGAGCAGGGGAAAAGTGG - Intergenic
1094497970 12:31001054-31001076 AAGAGTGGTCAGAGGGACAGGGG - Intergenic
1097879230 12:64672008-64672030 AAGTCTGAAGAGGGCCACAGGGG - Intronic
1099160722 12:79238390-79238412 ATGCCTGAAAAGAGGGCCAGTGG + Intronic
1100114564 12:91288424-91288446 AATTCTGACCACAGGGCCAGAGG - Intergenic
1100125171 12:91416031-91416053 AAGTCTGAACACAGCACCAGTGG - Intergenic
1101418600 12:104530408-104530430 AGGTCTCAAGACAGGGACAGAGG - Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1103456702 12:121072987-121073009 AAATTTGAACACAGGCACAGAGG - Intergenic
1103535484 12:121630823-121630845 AAGTATAAACTGAGGCACAGAGG - Intronic
1104020076 12:124986357-124986379 GAGTCTGCACACAGGAACAGGGG + Intronic
1105636830 13:22223829-22223851 AAGTAAGAACTGAGGCACAGAGG - Intergenic
1106305883 13:28508881-28508903 AAATTTGAACACAGGTACAGAGG + Intergenic
1111263119 13:85769799-85769821 AATCTTTAACAGAGGGACAGTGG - Intergenic
1111319949 13:86614312-86614334 AAGTCTGAGCAGGGTGACAGTGG + Intergenic
1113320860 13:109230649-109230671 AAGGCTGAAGAGAGGGAAATGGG + Intergenic
1114738866 14:25072778-25072800 AATACAGAACAGAGGGACTGTGG - Intergenic
1117064324 14:51994880-51994902 AAGTGTGAACAAAGAAACAGAGG - Intronic
1117205446 14:53438091-53438113 AAGCCTGTACAGAGGGCCAAGGG + Intergenic
1118176711 14:63447881-63447903 AGGCCTGAGAAGAGGGACAGAGG + Intronic
1118501469 14:66366173-66366195 AAGACTGGACAGAGAGGCAGAGG + Intergenic
1118502369 14:66373738-66373760 GAGTCTGAATTGAGGGACCGTGG - Intergenic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1119446013 14:74663942-74663964 TAATCTGAAATGAGGGACAGAGG + Exonic
1120102241 14:80458583-80458605 ATGTCTGAACAGATGAAGAGGGG - Intergenic
1120329980 14:83079736-83079758 AATTATTGACAGAGGGACAGAGG - Intergenic
1120431077 14:84416812-84416834 AACTGTAAACAGAGGGACAAAGG - Intergenic
1121363475 14:93284856-93284878 AAGTGAGAGCAGAGGGTCAGAGG + Intronic
1121692131 14:95885550-95885572 AAGTGTGAGCAGAAGCACAGAGG + Intergenic
1121835301 14:97086933-97086955 TAGTGAGCACAGAGGGACAGGGG - Intergenic
1122614884 14:103010429-103010451 GAGTCTCACCAGAGGGATAGGGG - Intronic
1123069673 14:105636328-105636350 CAGGCTGAAGAGAGGGGCAGAGG - Intergenic
1123094697 14:105761368-105761390 CAGGCTGAAGAGAGGGGCAGAGG - Intergenic
1124420324 15:29515384-29515406 CAGTCTTAACAGAGAGTCAGAGG - Intronic
1126528266 15:49682833-49682855 GAGTTGCAACAGAGGGACAGGGG - Intergenic
1126939360 15:53749470-53749492 AAGACTGAGGAGAGGGAGAGAGG - Intronic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1129825601 15:78633068-78633090 AGGACAGAACAGAGGGACATAGG - Intronic
1130044079 15:80430587-80430609 AAGCCAGCACAGAGGGACTGAGG - Intronic
1131270571 15:90945185-90945207 GAGGCTGAACAAAGGGAAAGTGG + Intronic
1132397271 15:101483048-101483070 GGGTGTGAACTGAGGGACAGAGG - Intronic
1134219342 16:12341388-12341410 AAGTCTGAGGAAAGGCACAGAGG - Intronic
1134289829 16:12895136-12895158 GAGTCTGAGCAGAGAGACAGGGG + Intergenic
1137016805 16:35385026-35385048 AAGGCTGGTCAGTGGGACAGTGG + Intergenic
1137361023 16:47815225-47815247 GACTCTGAAATGAGGGACAGAGG - Intergenic
1138136172 16:54524887-54524909 CAGCCTGAAGAGAGGCACAGAGG + Intergenic
1138392997 16:56683648-56683670 AAGTCTTCACAGCCGGACAGGGG - Intronic
1139914571 16:70420108-70420130 AAGTTTGAACCCGGGGACAGAGG - Intronic
1139966366 16:70747709-70747731 CTGTCTGCACAGGGGGACAGAGG + Intronic
1140297570 16:73724466-73724488 AAGTCTCACCAAAGGAACAGTGG - Intergenic
1140732087 16:77865509-77865531 GAGTCTTAACGGAGGGAGAGGGG + Intronic
1141724675 16:85779834-85779856 AAGACTGGCCAGAGGCACAGAGG - Exonic
1143287722 17:5802743-5802765 ACTGCTGATCAGAGGGACAGGGG - Intronic
1144022824 17:11252139-11252161 GGGTCTGGAGAGAGGGACAGGGG - Intronic
1144248013 17:13386870-13386892 AAATCTGAACAGGGGCTCAGGGG - Intergenic
1144829981 17:18125905-18125927 ATGACAGAACAGAGGGCCAGGGG + Intronic
1147185013 17:38708458-38708480 AAGCCTGGGCAGAGGCACAGAGG + Intronic
1149901200 17:60481077-60481099 AGGTCTGAAAAGAGGGCCCGTGG - Intronic
1151381754 17:73730567-73730589 AAGTGAGAACAGAGAAACAGAGG - Intergenic
1152100331 17:78297868-78297890 AAGAAAGAAGAGAGGGACAGAGG - Intergenic
1152757275 17:82092288-82092310 AGGTCTGAGCAGAGGCACTGAGG - Intronic
1153851484 18:9099493-9099515 ACGTCTGAAAAAAGGGACATGGG - Intergenic
1155230772 18:23772690-23772712 AAGTCTGCACAGAAACACAGAGG - Intronic
1156610360 18:38717793-38717815 AAGTTTCCACAGAGTGACAGGGG + Intergenic
1156711611 18:39953596-39953618 AGTTCTGAAGAGAGGGAAAGAGG + Intergenic
1156811184 18:41254145-41254167 AAATCTGAACTGAGGGGAAGGGG + Intergenic
1156854801 18:41769106-41769128 AAATCTGGACACAGAGACAGGGG + Intergenic
1157723390 18:49943899-49943921 AAGTCTGAACTGTAGGACATTGG + Intronic
1159393059 18:67819885-67819907 AATTCTGAACAGAGAGATAAGGG - Intergenic
1162042633 19:7979836-7979858 CAGTCTGAAGGCAGGGACAGAGG + Intronic
1166546859 19:43639412-43639434 GAGACTGGACAGAAGGACAGCGG + Intronic
1167713067 19:51124289-51124311 AGGACTGAGCAGAGGGACATGGG - Intergenic
1167752213 19:51387953-51387975 CAGTCTGCACAGAGGGGCCGTGG - Exonic
1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG + Intergenic
1168005586 19:53483967-53483989 AAGTGAGAAAAGAGGGACTGAGG - Intronic
1168042247 19:53768058-53768080 AAGTGTGAACAGAAGGGCAAAGG - Intergenic
925247281 2:2395250-2395272 AAGACAGAACAGAGAGGCAGGGG + Intergenic
925714546 2:6772386-6772408 AGGCCTGAACACAGAGACAGAGG - Intergenic
925821155 2:7801159-7801181 AAGGCTGCACAGAGCCACAGGGG - Intergenic
926055887 2:9773728-9773750 AAGTCTGAAGAGAGGGGAGGCGG - Intergenic
926388177 2:12359431-12359453 AACTCTTAACAGAAGGACTGAGG + Intergenic
926503623 2:13684045-13684067 CAGTCTGCACAGAGAGAAAGAGG - Intergenic
927201782 2:20582710-20582732 ATGTCCCAACTGAGGGACAGTGG + Intronic
927494735 2:23544829-23544851 ATGTTGGAACAGAGGGGCAGGGG + Intronic
927607142 2:24495728-24495750 AACTCTGACCAGACAGACAGAGG + Intronic
927622105 2:24672223-24672245 ACTTCTGAAAAAAGGGACAGAGG + Intronic
928162797 2:28944017-28944039 AAGTATGAACAGAGGACCTGTGG + Intronic
929048788 2:37816564-37816586 AAGTCTGATCACAGGGAGAAGGG - Intergenic
931273053 2:60719595-60719617 CAGCCTGAACAAAGGCACAGAGG + Intergenic
933074226 2:77903192-77903214 AAGTTGGAAAAGAGGAACAGTGG - Intergenic
933279422 2:80316593-80316615 AAGTCTGAACAGAGAGAGAGAGG + Intronic
936047907 2:109201095-109201117 AGGTCTGTGCTGAGGGACAGGGG - Intronic
938744867 2:134267915-134267937 ATGTCTCCACAGAGGGGCAGTGG + Intronic
939037771 2:137153065-137153087 AAGTTTCAAAAGGGGGACAGAGG + Intronic
939114560 2:138045485-138045507 CAGTCTGAAAAGAGGGAGAGTGG - Intergenic
939885289 2:147674866-147674888 ATGTCAGAACAGAGTGACAGGGG - Intergenic
941866694 2:170342976-170342998 AAGTCTAAATAAAGAGACAGTGG - Intronic
943266481 2:185738814-185738836 AGGTCCGGACAGAGGGACAACGG + Exonic
945168307 2:206969233-206969255 ACGTTTGAGCTGAGGGACAGTGG + Exonic
945174338 2:207027083-207027105 AAACCTGAACAGAGGAACAATGG + Intergenic
945295590 2:208168241-208168263 ATTTCTGAAAAGTGGGACAGGGG + Intronic
946899000 2:224354663-224354685 AACTCTGAACGTAGGAACAGAGG + Intergenic
948251493 2:236533646-236533668 AACTCTGAACAGTCGTACAGTGG + Intergenic
1169277863 20:4245698-4245720 CAGTGTGAACCGAGGGGCAGGGG + Intronic
1169424519 20:5485637-5485659 GAGCCTGAACAGAGGGAGAGGGG + Intergenic
1172652337 20:36512722-36512744 AAACCTGAAGAGAGGGAGAGAGG + Intronic
1173130779 20:40391208-40391230 AAGTCTGAAAGGAGGGACATGGG + Intergenic
1173152798 20:40582205-40582227 CAGGCTGAACAGATGGGCAGTGG - Intergenic
1173334921 20:42104724-42104746 AAGTCAGAAGAGAGGGAATGGGG + Intronic
1173856945 20:46256407-46256429 AGATCTGAAGTGAGGGACAGAGG + Intronic
1173942076 20:46919952-46919974 AGGCCTGAGCAGAGGGAGAGAGG + Intronic
1174348234 20:49947731-49947753 AAGACAGAACAGAGGGCCAAAGG - Intronic
1174688396 20:52478102-52478124 AAGGCTGAAAAGAATGACAGTGG + Intergenic
1175028120 20:55924721-55924743 AAGGCTGAGCACAGAGACAGGGG - Intergenic
1175856738 20:62124790-62124812 CAGCATGCACAGAGGGACAGTGG - Intronic
1178100534 21:29264050-29264072 AGGCCTGAAGAGAGGGAGAGAGG + Intronic
1179057053 21:37945825-37945847 AGGTATGAACAGAGGAACAAAGG + Intergenic
1179710299 21:43209512-43209534 AAGACTGTCCAGAGGGACAATGG + Intergenic
1180757617 22:18173602-18173624 AAGTTTAAACACAGGGACAAGGG + Intronic
1180800641 22:18630362-18630384 TGGTCTGAGCAGAGGGCCAGGGG + Intergenic
1180851873 22:19025919-19025941 TGGTCTGAGCAGAGGGCCAGGGG + Intergenic
1181074157 22:20363843-20363865 AAGTTTAAACACAGGGACAAGGG - Intronic
1181221078 22:21364900-21364922 TGGTCTGAGCAGAGGGCCAGGGG - Intergenic
1183173310 22:36203974-36203996 AGGTCTGAACAGAGGGACAGAGG + Intronic
1183178052 22:36238785-36238807 AGGTCTGAACAGAGGGACAGAGG + Intronic
1183180048 22:36253819-36253841 AAGTCTGAACAGAGGGACAGAGG - Exonic
1184561795 22:45268207-45268229 AGGTCTGAGCGGAGGGGCAGGGG - Intergenic
949944924 3:9182347-9182369 AAATTTGGACAGAGGCACAGAGG + Intronic
950707413 3:14791669-14791691 AAGGCTGCTGAGAGGGACAGAGG - Intergenic
953683795 3:45060481-45060503 AAGTCTTAATAGAGGGGTAGGGG + Intergenic
954869830 3:53759320-53759342 AATTCTGGAGAGAGGGAGAGAGG + Intronic
956304020 3:67804663-67804685 TATTCTGAACACTGGGACAGGGG - Intergenic
958177695 3:90017511-90017533 AAGTCTGAACAGAGTTGAAGGGG - Intergenic
959005914 3:101019735-101019757 ATGTCTGAACACAGGGCAAGGGG - Intergenic
961082544 3:124038658-124038680 AATGCTCAACAGAAGGACAGAGG - Intergenic
961568397 3:127780756-127780778 GTCTCTGAAAAGAGGGACAGGGG - Intronic
962300314 3:134235698-134235720 CAGTCTGAAAGCAGGGACAGTGG + Intronic
962880392 3:139571566-139571588 GGGTCTGAACAGAGAGAAAGAGG + Intronic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
963332246 3:143927410-143927432 AAATCTGAACCCAGGCACAGAGG - Intergenic
964967766 3:162518770-162518792 CATTCTCAAAAGAGGGACAGTGG - Intergenic
965012153 3:163107639-163107661 AAGGCTGCACAGAGCAACAGTGG + Intergenic
966324128 3:178735261-178735283 AAGGCAGGACAGAGGGACACAGG + Intronic
966874048 3:184311598-184311620 AAGTTTGTACAGAGGAAAAGAGG + Intronic
967830303 3:193912875-193912897 AAGTCTGAGCAGAGGCTCAAAGG - Intergenic
969094947 4:4725537-4725559 AAGTCTCAATATAGGGATAGAGG + Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
974151323 4:58013594-58013616 AAGGATGCACAGAGGAACAGAGG - Intergenic
975164296 4:71160561-71160583 AAATGTGGACAGAGGGAAAGGGG + Intergenic
975769583 4:77707017-77707039 CATTCAGAACAGAGGAACAGTGG - Intergenic
977901124 4:102423586-102423608 AGGTGTGAACAGAGAGACAGTGG + Intronic
978824377 4:113002897-113002919 GAGTCTGTACAGAGCCACAGAGG - Intronic
979254468 4:118597131-118597153 AGGTGTGCCCAGAGGGACAGAGG - Intergenic
985071558 4:186170790-186170812 AACACTGAACAGAGGGACAGAGG + Intronic
987057598 5:14209870-14209892 GCTTCTGCACAGAGGGACAGAGG + Intronic
987100197 5:14584267-14584289 ACCACTGAACAGATGGACAGTGG - Intronic
990213392 5:53504726-53504748 AAGTCTGAACAGAGGGGTGGTGG - Intergenic
991406525 5:66305711-66305733 GAAGCTGAACTGAGGGACAGAGG + Intergenic
992040190 5:72823284-72823306 AAGACTGGAGAGTGGGACAGTGG - Intronic
992086167 5:73280358-73280380 AAATCTGAAAACAGGGCCAGAGG + Intergenic
993435943 5:87894242-87894264 AAATTTAAACAGAGGAACAGAGG - Intergenic
994489961 5:100428480-100428502 AAGCCTGATAAGAGGGATAGAGG + Intergenic
994591762 5:101783140-101783162 TAGCAAGAACAGAGGGACAGAGG - Intergenic
995618069 5:113989516-113989538 AAGTCTGAAGAGAGGCACTCTGG - Intergenic
997659000 5:135575893-135575915 GAGTGAGAAGAGAGGGACAGAGG + Intronic
998100157 5:139426079-139426101 AAATCTGAATAGAGGTACAATGG - Intronic
998545790 5:143026468-143026490 AAATCTGAACAAAGGGAGGGAGG + Intronic
1001564985 5:172694260-172694282 AAGGCAGAACTGAGAGACAGAGG - Intergenic
1002377776 5:178800641-178800663 AATTCGAGACAGAGGGACAGAGG - Intergenic
1005185611 6:23160669-23160691 AGGTCTGAACAGAGGCCTAGGGG - Intergenic
1006302537 6:33201223-33201245 CACGCTGACCAGAGGGACAGAGG - Exonic
1007502261 6:42307310-42307332 AAACCTGAATAAAGGGACAGAGG - Intronic
1010579082 6:77571967-77571989 AAGAGTGAACAGCGGGCCAGTGG + Intergenic
1010987211 6:82438557-82438579 AAGACTGAACAGAGGAAGTGAGG + Intergenic
1011555798 6:88570359-88570381 AAGGCTGCACAGAGGAGCAGGGG + Intergenic
1013316194 6:108945616-108945638 AAGTCTAAACAGAATGAGAGAGG - Intronic
1014910763 6:127090198-127090220 AAGAGGGAACAAAGGGACAGAGG + Intergenic
1016266536 6:142238940-142238962 AAAGCTGAAAAGAGGGAGAGAGG - Intergenic
1016506505 6:144786618-144786640 AAGCCTGAGCAAAGGCACAGAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018164286 6:161078814-161078836 CAGTCTGAAGAGGGGGCCAGTGG + Intronic
1018584039 6:165335857-165335879 CACTCTGAAGAGAGGGACAGTGG - Intronic
1018966962 6:168497004-168497026 AAGGCTGAGCAGAGGGCTAGAGG + Intronic
1020901803 7:14012776-14012798 ATGGCTGAACAGAGAGGCAGGGG + Intergenic
1022062810 7:26817315-26817337 AAATCAGAACAGAAAGACAGGGG + Intronic
1023184355 7:37517449-37517471 AATTTTGAAGAGAGGGATAGAGG + Intergenic
1024069560 7:45774797-45774819 AAGCGTGCCCAGAGGGACAGAGG - Intergenic
1025059715 7:55795417-55795439 GAATCTGAAAAGAGGGACACAGG + Exonic
1025887124 7:65606811-65606833 AGGTCTGCTCAGAGGAACAGAGG - Intergenic
1027891148 7:83977140-83977162 AAGTCTGAACAGTGAGTCAGTGG + Exonic
1028173169 7:87623865-87623887 AATATTGAACAGAGGGACATTGG - Intronic
1028181995 7:87735111-87735133 AAGGGTGAACAGAGTTACAGGGG - Intronic
1030231516 7:107212864-107212886 AAGTCAGCACAGAGCCACAGGGG + Intronic
1030394378 7:108967098-108967120 AAGACTGAACAGAGGGCTTGAGG - Intergenic
1031855292 7:126915117-126915139 AGGTCTGCTCAGAGGAACAGAGG + Intronic
1032034053 7:128508624-128508646 AAGGCTGAAGAGGGTGACAGGGG - Intergenic
1032103279 7:129001543-129001565 AACTGTGCACAGAGGGGCAGGGG + Intronic
1032272345 7:130421389-130421411 AAGCATGAAAAGAGGCACAGTGG + Intronic
1034324966 7:150221452-150221474 AAGTCTGAACAGGGGACCAAGGG + Intergenic
1034441815 7:151089489-151089511 AAGTCTAAACAGAGTGAGGGAGG - Intronic
1034501512 7:151453652-151453674 GAGTCTGAACACTGGGCCAGTGG + Intergenic
1034768230 7:153747799-153747821 AAGTCTGAACAGGGGACCAAGGG - Intergenic
1035538817 8:415602-415624 ATGTCTGCACAGCTGGACAGAGG + Intronic
1037470992 8:19210618-19210640 AAGTCATAACAGAGGCATAGTGG + Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1040499421 8:47993792-47993814 ATGTATGAACAGCGGGACATAGG - Intergenic
1042019221 8:64352559-64352581 AAGCCTGGAGAGAGGGACAGAGG + Intergenic
1042056990 8:64774602-64774624 AAGTGTGAACATTGGGAGAGGGG + Intronic
1042953921 8:74228314-74228336 AAGTCTACCCAGATGGACAGAGG + Intergenic
1043502315 8:80870384-80870406 AGGTGTGGACAGAGGGACACAGG - Intronic
1044357749 8:91244385-91244407 AAGAATGAAAAGAGGGAAAGAGG - Intronic
1045774408 8:105785394-105785416 AAGTCCAAACACAGGGTCAGTGG - Intronic
1045891997 8:107168497-107168519 AGGTCCTAACAGAGGGAAAGGGG - Intergenic
1046868995 8:119183640-119183662 AGGACTGAAGAGAGGGAAAGAGG - Intronic
1047305175 8:123646884-123646906 GAGTCTGAACAGAGGATCACTGG - Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1047540187 8:125757489-125757511 AGGCCTGCACAGAGGGAGAGTGG - Intergenic
1048321385 8:133403291-133403313 AAGGCAGAACAGAGGGTGAGAGG + Intergenic
1049835669 8:144734119-144734141 AGGTCCCAACAGAGGGACTGTGG - Intronic
1052210468 9:25896943-25896965 AAATATGAACAGAAGGACTGAGG - Intergenic
1052857884 9:33418308-33418330 AAGTCTGGACAGGTGGATAGTGG - Intergenic
1053522003 9:38790049-38790071 AAATCTTCACAGAGGAACAGAGG + Intergenic
1054194168 9:62014038-62014060 AAATCTTCACAGAGGAACAGAGG + Intergenic
1054644239 9:67574653-67574675 AAATCTTCACAGAGGAACAGAGG - Intergenic
1056543162 9:87591932-87591954 AAGTCTAAACAGGGGGCCTGTGG + Intronic
1060403743 9:123362728-123362750 CAGTATGGACAGAGGGCCAGGGG - Intronic
1060614534 9:124999489-124999511 AAGACTGACCTGAGTGACAGAGG + Intronic
1061067557 9:128288094-128288116 AGGTATGAACAGAGGGGCGGTGG + Intronic
1061960070 9:133983398-133983420 AGGGCTCAACAGAGGCACAGGGG + Intronic
1186658183 X:11639151-11639173 AAGTCTGAAACAAGGGACATTGG + Intronic
1186973732 X:14877004-14877026 TAGTCTGAACTGAGGCACTGAGG + Intronic
1188355330 X:29183611-29183633 AAGTTTGAACAAAGAGCCAGAGG - Intronic
1189712363 X:43826694-43826716 AAGTATGAGCAGAAGGAAAGGGG + Intronic
1192706715 X:73533841-73533863 GAGTCTGAAAAGAGAGTCAGTGG - Intergenic
1193644051 X:84045552-84045574 AAGTCTTATCAGACTGACAGTGG - Intergenic
1196052900 X:111324229-111324251 AAGCATGAACAAAGGGGCAGAGG - Intronic
1196764435 X:119230081-119230103 CATTCTGAACAAAGGTACAGAGG - Intergenic
1198120101 X:133583935-133583957 GATTCTGCACACAGGGACAGTGG - Intronic
1200143772 X:153915187-153915209 AACTCTGTAGAGACGGACAGTGG + Intronic
1202110857 Y:21417902-21417924 AAGTGAGGACAGAGGGAGAGGGG + Intergenic