ID: 1183183570

View in Genome Browser
Species Human (GRCh38)
Location 22:36278166-36278188
Sequence CTGTGAGTGGCCGGGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183570_1183183580 30 Left 1183183570 22:36278166-36278188 CCACTGGTCCCGGCCACTCACAG No data
Right 1183183580 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
1183183570_1183183577 2 Left 1183183570 22:36278166-36278188 CCACTGGTCCCGGCCACTCACAG No data
Right 1183183577 22:36278191-36278213 CGGCCACTAGCAGTGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183570 Original CRISPR CTGTGAGTGGCCGGGACCAG TGG (reversed) Intergenic