ID: 1183183572

View in Genome Browser
Species Human (GRCh38)
Location 22:36278174-36278196
Sequence TGGCCGGGCTGTGAGTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183572_1183183577 -6 Left 1183183572 22:36278174-36278196 CCCGGCCACTCACAGCCCGGCCA No data
Right 1183183577 22:36278191-36278213 CGGCCACTAGCAGTGTCTCATGG No data
1183183572_1183183580 22 Left 1183183572 22:36278174-36278196 CCCGGCCACTCACAGCCCGGCCA No data
Right 1183183580 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183572 Original CRISPR TGGCCGGGCTGTGAGTGGCC GGG (reversed) Intergenic