ID: 1183183573

View in Genome Browser
Species Human (GRCh38)
Location 22:36278175-36278197
Sequence GTGGCCGGGCTGTGAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183573_1183183580 21 Left 1183183573 22:36278175-36278197 CCGGCCACTCACAGCCCGGCCAC No data
Right 1183183580 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
1183183573_1183183577 -7 Left 1183183573 22:36278175-36278197 CCGGCCACTCACAGCCCGGCCAC No data
Right 1183183577 22:36278191-36278213 CGGCCACTAGCAGTGTCTCATGG No data
1183183573_1183183581 30 Left 1183183573 22:36278175-36278197 CCGGCCACTCACAGCCCGGCCAC No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183573 Original CRISPR GTGGCCGGGCTGTGAGTGGC CGG (reversed) Intergenic