ID: 1183183574

View in Genome Browser
Species Human (GRCh38)
Location 22:36278179-36278201
Sequence GCTAGTGGCCGGGCTGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183574_1183183580 17 Left 1183183574 22:36278179-36278201 CCACTCACAGCCCGGCCACTAGC No data
Right 1183183580 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
1183183574_1183183582 27 Left 1183183574 22:36278179-36278201 CCACTCACAGCCCGGCCACTAGC No data
Right 1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG No data
1183183574_1183183581 26 Left 1183183574 22:36278179-36278201 CCACTCACAGCCCGGCCACTAGC No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183574 Original CRISPR GCTAGTGGCCGGGCTGTGAG TGG (reversed) Intergenic