ID: 1183183576

View in Genome Browser
Species Human (GRCh38)
Location 22:36278190-36278212
Sequence CATGAGACACTGCTAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183576_1183183582 16 Left 1183183576 22:36278190-36278212 CCGGCCACTAGCAGTGTCTCATG No data
Right 1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG No data
1183183576_1183183580 6 Left 1183183576 22:36278190-36278212 CCGGCCACTAGCAGTGTCTCATG No data
Right 1183183580 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
1183183576_1183183581 15 Left 1183183576 22:36278190-36278212 CCGGCCACTAGCAGTGTCTCATG No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data
1183183576_1183183584 30 Left 1183183576 22:36278190-36278212 CCGGCCACTAGCAGTGTCTCATG No data
Right 1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183576 Original CRISPR CATGAGACACTGCTAGTGGC CGG (reversed) Intergenic