ID: 1183183578

View in Genome Browser
Species Human (GRCh38)
Location 22:36278194-36278216
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183578_1183183584 26 Left 1183183578 22:36278194-36278216 CCACTAGCAGTGTCTCATGGACA No data
Right 1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG No data
1183183578_1183183580 2 Left 1183183578 22:36278194-36278216 CCACTAGCAGTGTCTCATGGACA No data
Right 1183183580 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
1183183578_1183183582 12 Left 1183183578 22:36278194-36278216 CCACTAGCAGTGTCTCATGGACA No data
Right 1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG No data
1183183578_1183183581 11 Left 1183183578 22:36278194-36278216 CCACTAGCAGTGTCTCATGGACA No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183578 Original CRISPR TGTCCATGAGACACTGCTAG TGG (reversed) Intergenic