ID: 1183183579

View in Genome Browser
Species Human (GRCh38)
Location 22:36278219-36278241
Sequence CCATATGAGGAAAGACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183579_1183183588 18 Left 1183183579 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
Right 1183183588 22:36278260-36278282 AACAGGTGTCAGCTTCAGGAAGG No data
1183183579_1183183587 14 Left 1183183579 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
Right 1183183587 22:36278256-36278278 GAGTAACAGGTGTCAGCTTCAGG No data
1183183579_1183183589 30 Left 1183183579 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
Right 1183183589 22:36278272-36278294 CTTCAGGAAGGTTCAGAAGTAGG No data
1183183579_1183183584 1 Left 1183183579 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
Right 1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183579 Original CRISPR CCATATGAGGAAAGACAAAA AGG (reversed) Intergenic