ID: 1183183581

View in Genome Browser
Species Human (GRCh38)
Location 22:36278228-36278250
Sequence CTTTCCTCATATGGAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183578_1183183581 11 Left 1183183578 22:36278194-36278216 CCACTAGCAGTGTCTCATGGACA No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data
1183183576_1183183581 15 Left 1183183576 22:36278190-36278212 CCGGCCACTAGCAGTGTCTCATG No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data
1183183575_1183183581 16 Left 1183183575 22:36278189-36278211 CCCGGCCACTAGCAGTGTCTCAT No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data
1183183573_1183183581 30 Left 1183183573 22:36278175-36278197 CCGGCCACTCACAGCCCGGCCAC No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data
1183183574_1183183581 26 Left 1183183574 22:36278179-36278201 CCACTCACAGCCCGGCCACTAGC No data
Right 1183183581 22:36278228-36278250 CTTTCCTCATATGGAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183581 Original CRISPR CTTTCCTCATATGGAAAAAT TGG Intergenic