ID: 1183183582

View in Genome Browser
Species Human (GRCh38)
Location 22:36278229-36278251
Sequence TTTCCTCATATGGAAAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183578_1183183582 12 Left 1183183578 22:36278194-36278216 CCACTAGCAGTGTCTCATGGACA No data
Right 1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG No data
1183183574_1183183582 27 Left 1183183574 22:36278179-36278201 CCACTCACAGCCCGGCCACTAGC No data
Right 1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG No data
1183183576_1183183582 16 Left 1183183576 22:36278190-36278212 CCGGCCACTAGCAGTGTCTCATG No data
Right 1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG No data
1183183575_1183183582 17 Left 1183183575 22:36278189-36278211 CCCGGCCACTAGCAGTGTCTCAT No data
Right 1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183582 Original CRISPR TTTCCTCATATGGAAAAATT GGG Intergenic