ID: 1183183584

View in Genome Browser
Species Human (GRCh38)
Location 22:36278243-36278265
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183183578_1183183584 26 Left 1183183578 22:36278194-36278216 CCACTAGCAGTGTCTCATGGACA No data
Right 1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG No data
1183183579_1183183584 1 Left 1183183579 22:36278219-36278241 CCTTTTTGTCTTTCCTCATATGG No data
Right 1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG No data
1183183576_1183183584 30 Left 1183183576 22:36278190-36278212 CCGGCCACTAGCAGTGTCTCATG No data
Right 1183183584 22:36278243-36278265 AAAATTGGGCCCTGAGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183183584 Original CRISPR AAAATTGGGCCCTGAGTAAC AGG Intergenic