ID: 1183186910

View in Genome Browser
Species Human (GRCh38)
Location 22:36297050-36297072
Sequence TGACACGGAGACAGAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183186910_1183186912 24 Left 1183186910 22:36297050-36297072 CCATGGGTTCTGTCTCCGTGTCA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183186910 Original CRISPR TGACACGGAGACAGAACCCA TGG (reversed) Intronic
901134206 1:6982647-6982669 GGACAGGGAGCCAGAACCCGGGG - Intronic
902712933 1:18253041-18253063 TGACACAGGGACAGCACCCAGGG - Intronic
902821054 1:18943772-18943794 CGACATGGAGACAAACCCCACGG + Intronic
903005522 1:20295663-20295685 GGAGACAGAGACAGGACCCAGGG + Intronic
906804527 1:48767492-48767514 TGAGGAGGAGACAGAACACAGGG + Intronic
911584243 1:99672199-99672221 TAACTCAGAGACAGAAACCATGG - Intronic
918043850 1:180929333-180929355 AGACACCGAGTCAGAACCCTGGG - Intronic
919251648 1:195064368-195064390 TGACACAGAGAGAGAAACAAAGG + Intergenic
921002139 1:211055225-211055247 TGGCATGGAGAGAGAATCCAGGG + Intronic
921069734 1:211649152-211649174 TCACACGGAGCCAGGACTCACGG - Intergenic
923389908 1:233503891-233503913 TGCCACAGAGACAGAACCAAAGG + Intergenic
923794193 1:237137279-237137301 TGACAAGGTGACAGAGACCATGG - Intronic
924313597 1:242773439-242773461 TGACTCGAAGAAAGAAGCCACGG + Intergenic
1063574102 10:7245629-7245651 AGAAACAGAAACAGAACCCAAGG + Intronic
1068033493 10:51731959-51731981 GGACACAGAGAAAGACCCCAGGG - Intronic
1068321302 10:55420529-55420551 TGACACGCAGAGAAATCCCAAGG + Intronic
1068652390 10:59536940-59536962 AGACACAGACACTGAACCCAGGG - Intergenic
1070074785 10:73124230-73124252 TGAAATGGAGACAGAGCTCAAGG + Exonic
1070439932 10:76433271-76433293 TGACACAGTGACAGAAAACAAGG - Intronic
1071071206 10:81696760-81696782 TGACAGGCTGACATAACCCATGG + Intergenic
1071404281 10:85314915-85314937 GGACAAGGACACAGAAACCATGG + Intergenic
1072563041 10:96594512-96594534 ATCCACGGACACAGAACCCATGG + Exonic
1075096598 10:119475439-119475461 TGACACGGACACTCAACACACGG + Intergenic
1083147452 11:60769894-60769916 TGACACGGAGACAGAGGACCAGG - Intronic
1083253365 11:61482276-61482298 TAACGGGGAGACAGACCCCAAGG - Intronic
1083541737 11:63516130-63516152 GGACACGAAGACTGGACCCAGGG - Intronic
1084551096 11:69842684-69842706 TGAAACAAGGACAGAACCCAGGG + Intergenic
1084735246 11:71101240-71101262 TGACACGGAGGCAGGGGCCAGGG - Intronic
1084749234 11:71193264-71193286 TGAGACGGCCCCAGAACCCATGG - Intronic
1088587474 11:111372143-111372165 TGCCACGGAGGCAGAAGCCTTGG + Intronic
1088594005 11:111426358-111426380 AGACACGGAGAGAGAACCATGGG - Intronic
1090711315 11:129388377-129388399 AGACACGGACACAGACCCCAGGG - Intronic
1096872336 12:54601215-54601237 CAACAGAGAGACAGAACCCAAGG + Intergenic
1100669256 12:96792478-96792500 TCCCAAGGAGACAGAACCTATGG + Exonic
1101198850 12:102413811-102413833 TGACCCGGAAACAGAAGCAATGG + Intronic
1103670606 12:122611960-122611982 TTCCACGAATACAGAACCCATGG + Intronic
1103684649 12:122722376-122722398 TGACACTGAGTCAGGACCCTTGG + Intergenic
1107564348 13:41586642-41586664 TAACACAGAGACACAACTCAGGG + Intronic
1112279222 13:98047995-98048017 CTACACGGGGACTGAACCCAGGG + Intergenic
1119147661 14:72331591-72331613 TGACACAAGGACAGTACCCACGG - Intronic
1120150661 14:81029784-81029806 TGGCAAGGATACAGAATCCATGG - Intronic
1120628177 14:86855441-86855463 TGAGATGGTGACAGAAGCCAAGG + Intergenic
1121008396 14:90504983-90505005 AGACACGGACCCAGAACCAAAGG + Intergenic
1121523348 14:94601281-94601303 GGACACAGAGAGAGAACCCATGG + Intronic
1122997352 14:105272395-105272417 GGACGTGGAGACAGCACCCAAGG + Intronic
1124069331 15:26376986-26377008 AAACACGAAGATAGAACCCAAGG - Intergenic
1126584018 15:50265627-50265649 TGAGAAGGAGCCAGAGCCCAAGG - Exonic
1127561191 15:60137985-60138007 CCACATGGAGGCAGAACCCAGGG - Intergenic
1129700528 15:77765551-77765573 TGAGAAGCAGACAGACCCCAAGG + Intronic
1132389396 15:101427486-101427508 TGAGTGGGAGTCAGAACCCAGGG + Intronic
1133097832 16:3458945-3458967 CCAAACGGAGACAGGACCCAGGG + Intronic
1134295370 16:12940748-12940770 TTAGAAAGAGACAGAACCCATGG - Intronic
1135618492 16:23932775-23932797 TTACAAGGAAACAGAAACCAGGG - Intronic
1136221369 16:28831258-28831280 TGCCAAGCAGACACAACCCATGG - Intronic
1141486241 16:84342159-84342181 GGACACGGAGACAGAGGCAAAGG - Intergenic
1148733889 17:49853766-49853788 CCACATGGAGACAGCACCCACGG + Intergenic
1149855879 17:60082180-60082202 TGACCCTGAAACAGAACTCAAGG - Intergenic
1151375410 17:73685142-73685164 TGACAGGGATAGAGAAACCAAGG + Intergenic
1152255069 17:79234200-79234222 GGACAAAGAGACAGAGCCCAGGG - Intronic
1152718338 17:81910610-81910632 TGACTCGGACACAGAAGACAAGG + Intronic
1152997822 18:424802-424824 GGACACAGAGGCAGAAACCAAGG + Intronic
1154490902 18:14921450-14921472 TGAGCAGGAGACACAACCCAAGG + Intergenic
1158937967 18:62382568-62382590 TGACAATGAGACAGTTCCCAGGG - Intronic
1163020317 19:14478048-14478070 TGACCCCCAAACAGAACCCAAGG + Exonic
1164211222 19:23099084-23099106 TCACACAGGGACAGAACCCACGG + Intronic
1164479731 19:28602196-28602218 CCACACGGAGACAGATCCCTGGG + Intergenic
1165901242 19:39170238-39170260 GGACACCGAGGCAGAGCCCAGGG + Intronic
1166103629 19:40586718-40586740 GGCCACAGAGACAGAAACCAGGG - Intronic
1166304377 19:41929307-41929329 TAACACATAGGCAGAACCCAGGG + Intronic
926304698 2:11629380-11629402 TGACTTGGTGACAGAGCCCAAGG + Intronic
929469864 2:42180887-42180909 TGTCAAGGTGACAAAACCCAAGG - Intronic
931322836 2:61188611-61188633 TGACATGAAAACAGAAACCAGGG - Exonic
933437206 2:82263027-82263049 TGCCATGGAGCCAGAGCCCAGGG - Intergenic
934774956 2:96931510-96931532 TGACACAGAGACAGAAAAGACGG + Intronic
935432682 2:102993274-102993296 TGCCAAGGACAGAGAACCCAAGG - Intergenic
935757230 2:106285526-106285548 TCAGAGGGAGACAGCACCCAGGG + Intergenic
936160470 2:110080706-110080728 GGCCACTGAGACAGAAGCCAAGG - Intergenic
936184194 2:110290648-110290670 GGCCACTGAGACAGAAGCCAAGG + Intergenic
936688113 2:114852341-114852363 ACCCACGGATACAGAACCCATGG - Intronic
940112922 2:150174065-150174087 TGACACAGAGTCAGCACCTACGG - Intergenic
940817952 2:158317652-158317674 TGTCACGGAACCAGAACCCAAGG - Intronic
940962150 2:159797961-159797983 TGACCCGGAGCCAGGACCCACGG + Intronic
944821161 2:203432972-203432994 TGACAGGAAAACAGAACGCATGG - Exonic
947204532 2:227648208-227648230 GGCCACGGAGACAGAGGCCAAGG + Intergenic
947209913 2:227699166-227699188 AGCCACGGAGACAGAGGCCAAGG + Exonic
947858219 2:233338827-233338849 TGACTGGGAGACAGAAAGCAAGG + Intronic
948199253 2:236118224-236118246 TGACACGGAGAAATCACTCAGGG - Intronic
1170613884 20:17934201-17934223 TGAGACAGAGGCAGAACCCTGGG + Intergenic
1173250018 20:41359457-41359479 TGACAGGGAGACAGATATCAAGG - Exonic
1174097180 20:48098582-48098604 AAACACGGAGACAGAATCCTGGG + Intergenic
1174176025 20:48645597-48645619 TGACACTGAGGCAGAACAGATGG + Intronic
1174208123 20:48856131-48856153 TGGCCCTGAGGCAGAACCCAGGG + Intergenic
1175856960 20:62126308-62126330 CGAGGCGGAGGCAGAACCCAGGG - Exonic
1177147281 21:17420367-17420389 AGACCTGGAGACAGAAACCAAGG - Intergenic
1178681669 21:34677558-34677580 ATACAGGGAGACAGAACACAAGG - Intronic
1182550270 22:31097122-31097144 AGACACGGAGAGAGAGCTCAAGG - Intronic
1182613285 22:31567357-31567379 TAACAGGGAGCCAGAACGCAGGG + Intronic
1183186910 22:36297050-36297072 TGACACGGAGACAGAACCCATGG - Intronic
949205569 3:1434447-1434469 TGACATGGGTACAGAACACAAGG + Intergenic
950907374 3:16551701-16551723 TGAAATGGAGACATAGCCCAAGG + Intergenic
951051880 3:18102772-18102794 TAAAACAGAGACATAACCCATGG - Intronic
958920098 3:100095366-100095388 ATTCACGGATACAGAACCCAAGG - Intronic
959612874 3:108314560-108314582 TGACATGGAGAGAGGAGCCATGG - Intronic
962590039 3:136880414-136880436 TGACACAGAGACAGAACACCAGG + Intronic
964158586 3:153617712-153617734 GGACAGGGTGCCAGAACCCAGGG - Intergenic
968205273 3:196794376-196794398 TGAGAAGGAGACAGTTCCCAGGG + Intronic
968790852 4:2660366-2660388 TGACAGGGAGACAGGACAGACGG - Intronic
968963887 4:3759720-3759742 TGACATGGAGACGGGACCCCTGG - Intergenic
971453458 4:26821715-26821737 TGCCAGGGAGTCAGAAGCCATGG + Intergenic
981165825 4:141555925-141555947 TGTCAGGCAAACAGAACCCAAGG + Intergenic
982222684 4:153138293-153138315 TGAAAAGGAGAAAGCACCCAAGG + Intergenic
985605176 5:854374-854396 AGCCAGGGAGACAGACCCCACGG + Intronic
986789936 5:11149723-11149745 TGACACAGAGGAAGAGCCCAGGG + Intronic
998859482 5:146428556-146428578 TGACACGGAGAGAGCTGCCAAGG + Intergenic
1001503223 5:172255375-172255397 TGACACCGAGACAGGGTCCACGG + Intronic
1001999621 5:176190438-176190460 GGCCACAGAGACAGAACCCAGGG + Intergenic
1002649530 5:180681397-180681419 GGCCACAGAGACAGAACCCAGGG - Intergenic
1003178236 6:3769908-3769930 CATCAAGGAGACAGAACCCATGG + Intergenic
1005851614 6:29827539-29827561 AGACACTGAGACAGAACGCTTGG + Intronic
1006124201 6:31827259-31827281 TGCCTCGGAGAAAGGACCCAAGG + Intergenic
1006335426 6:33418045-33418067 TCACACGGAGAAACAACCCCAGG + Intronic
1007386566 6:41524145-41524167 TGCCACGGAAACAGAGGCCACGG + Intergenic
1012582255 6:100883109-100883131 TGACACATATACAGAAGCCATGG - Intergenic
1020375755 7:7484250-7484272 AGACATGGAAACAGAAACCATGG + Intronic
1024006633 7:45229130-45229152 TGCCAAGGAGACAGACCCGAAGG - Intergenic
1029627269 7:101727808-101727830 TGACACTGAGGCAGAAACAAGGG + Intergenic
1031482181 7:122291171-122291193 TGAGAAGGAGACAGTTCCCAGGG - Intergenic
1032307941 7:130754521-130754543 AGACAGGGACTCAGAACCCAAGG - Intergenic
1032381746 7:131491507-131491529 TCACAGGGAGATAGAAGCCAGGG - Exonic
1033123849 7:138689946-138689968 GGACACAGAGACAGCACACAGGG + Intronic
1037790562 8:21936281-21936303 GGACACAGAGACAGAGGCCATGG - Intronic
1044953059 8:97452185-97452207 AAACATGGAGGCAGAACCCAGGG + Intergenic
1048165731 8:132059661-132059683 TGACCCTGAGACATAATCCATGG - Intronic
1053827220 9:42037670-42037692 TGACAGGGAGAAAGGAACCAAGG + Intronic
1056282732 9:85057789-85057811 TGACAGCGAGAAAGAAACCAGGG - Intergenic
1056398108 9:86199925-86199947 TGACAAGGAGAAAGAACCAATGG - Intergenic
1056533299 9:87506107-87506129 AGACATGGACCCAGAACCCAGGG + Intronic
1056636787 9:88337908-88337930 TGGCCCAGAGACAGCACCCAAGG + Intergenic
1057239105 9:93392746-93392768 TGGCATGGATACAGGACCCAAGG - Intergenic
1058021580 9:100095339-100095361 TGAGATGGAGAGAGAACCTAGGG + Intronic
1058398522 9:104585592-104585614 TAACATGGAGAAAGAACACACGG + Intergenic
1058556507 9:106174338-106174360 TGGGAGGGAGACAGATCCCAGGG + Intergenic
1059337220 9:113576691-113576713 CTACAGGGAGACAGAGCCCAGGG + Intronic
1185910724 X:3978496-3978518 TACCACGGAGACAGAACCTATGG + Intergenic
1186113307 X:6278236-6278258 GGACACAGAGACAAAACACAGGG - Intergenic
1187364394 X:18654543-18654565 TGACAAGGAGACAGAAATGAAGG - Intronic
1190683654 X:52851520-52851542 GGACACGAAGAAAGAAACCAAGG - Intergenic
1191653544 X:63569647-63569669 TGACACATACAAAGAACCCATGG + Intergenic
1194154777 X:90374234-90374256 GGACACAGAGACAGACACCAGGG + Intergenic
1199176776 X:144797763-144797785 TGTCAGGAAGACAGAACCCTGGG - Intergenic
1199619810 X:149689113-149689135 TGACAAGGACGCAGAAACCATGG - Intronic
1200501128 Y:3951121-3951143 GGACACAGAGACAGACACCAGGG + Intergenic
1200859294 Y:7973262-7973284 TGACATGCAGGCAGAAACCAGGG + Intergenic
1201483645 Y:14468827-14468849 GGACACGGAGACAAAACACAGGG + Intergenic