ID: 1183186911

View in Genome Browser
Species Human (GRCh38)
Location 22:36297065-36297087
Sequence TTTTGTATAAGTAATTGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 791}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183186911_1183186912 9 Left 1183186911 22:36297065-36297087 CCGTGTCAATTACTTATACAAAA 0: 1
1: 0
2: 0
3: 40
4: 791
Right 1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183186911 Original CRISPR TTTTGTATAAGTAATTGACA CGG (reversed) Intronic
900676408 1:3889522-3889544 TTTTGTATTATTAGTAGACACGG - Exonic
901474776 1:9481983-9482005 TTTTGTATATTTAATAGAGATGG + Intergenic
901587369 1:10308455-10308477 TGTTGTTTAAGAAATTGAGAGGG - Intronic
901676032 1:10885718-10885740 TTTTGTATATGTAGTAGAGATGG - Intergenic
903119413 1:21205290-21205312 TTTTGTATTATTAATAGAGATGG - Intergenic
903241571 1:21986196-21986218 TTTTGTATATTTAATAGAGATGG - Intronic
903710014 1:25316447-25316469 TTTTGTATTATTAATAGAGACGG - Intronic
903717101 1:25375959-25375981 TTTTGTATTATTAATAGAGACGG + Intronic
903738039 1:25542874-25542896 TTTTGTATTATTAATAGAGATGG - Intergenic
903982374 1:27198628-27198650 TTTTGTATTATTAATAGAGACGG + Intergenic
904020491 1:27460972-27460994 TTTTGTATATTTAATAGAGACGG - Intronic
904085000 1:27899979-27900001 TTTTGTATTTTTAATAGACAGGG + Intronic
904153448 1:28462536-28462558 TTTTGTATTTTTAATAGACAGGG + Intronic
904455812 1:30647443-30647465 TGTGGTACCAGTAATTGACAAGG - Intergenic
904521086 1:31096562-31096584 TTTTGTATTTTTAGTTGACACGG + Intergenic
904654533 1:32034388-32034410 TTTTGTATTTTTAATAGACAGGG - Intronic
904726571 1:32553228-32553250 TTTTGTATACTTAATAGAGATGG + Intronic
904906968 1:33904816-33904838 TTTTGTATTTTTAATAGACATGG + Intronic
905056322 1:35096993-35097015 TTTTGTATTTTTAATTGAGATGG + Intronic
905140883 1:35843234-35843256 TTTTGTATATTTAGTTGAGACGG + Intronic
905332679 1:37217858-37217880 TGTTTTATAAGTAATTTTCAGGG - Intergenic
905819983 1:40981416-40981438 TTTTGTAGAAGTAACTCACTCGG + Intronic
906032571 1:42733243-42733265 TTTTGTATTTTTAATAGACACGG + Exonic
906385868 1:45368164-45368186 TTTTGTATATTTAATAGAGATGG + Intronic
906432641 1:45767614-45767636 TTTTGTATATTTAATAGAGATGG - Intergenic
907130218 1:52090910-52090932 TTTTTTATTTTTAATTGACACGG + Intergenic
907209204 1:52804440-52804462 TTTTGTATTTTTAATAGACATGG - Intronic
907265273 1:53255647-53255669 TTTTTCATAAGTAATTGAAATGG + Intronic
907358097 1:53892907-53892929 TTTTTTTTAAATAATTGAGACGG - Intronic
908752289 1:67435797-67435819 TTTTGTATATTTAATAGAGATGG - Intergenic
910833018 1:91479336-91479358 TGTTGAGTAAGTAAGTGACAGGG - Intergenic
911727102 1:101253991-101254013 TTGTGTATAGCTAATTGAAAAGG - Intergenic
912055126 1:105587104-105587126 TTTTGTATAAGAAATTGTTACGG + Intergenic
912074375 1:105853698-105853720 TTTTGTATGAGAATTTGACTGGG - Intergenic
912355005 1:109047770-109047792 TTTTGTATTATTAATAGAGATGG - Intergenic
913349865 1:117845519-117845541 TTTTGTATTTGTAGTAGACAGGG - Intergenic
913365413 1:118032762-118032784 TTTTGTATTTTTAATAGACACGG + Intronic
913405164 1:118482971-118482993 TTTTGTATGAGGTATTGCCAGGG - Intergenic
913591194 1:120327936-120327958 TTTTGTTAAACTACTTGACAAGG - Intergenic
913652172 1:120927163-120927185 TTTTGTTAAACTACTTGACAAGG + Intergenic
914168936 1:145201907-145201929 TTTTGTTAAACTACTTGACAAGG - Intergenic
914464904 1:147918475-147918497 TTATAGATAAGTAATAGACAGGG + Intergenic
914524056 1:148445862-148445884 TTTTGTTAAACTACTTGACAAGG - Intergenic
914599620 1:149190009-149190031 TTTTGTTAAACTACTTGACAAGG + Intergenic
914642348 1:149621274-149621296 TTTTGTTAAACTACTTGACAAGG + Intergenic
914665328 1:149828037-149828059 TTTTGTATATGTAGTAGAGACGG + Intergenic
914670437 1:149865757-149865779 TTTTGTATATGTAGTAGAGACGG - Intronic
914828354 1:151152223-151152245 TTTTGTATTTTTAATCGACACGG - Intergenic
915012862 1:152705435-152705457 TTTTGTAAAGATAATTGATATGG - Intergenic
915045592 1:153011766-153011788 TTATTATTAAGTAATTGACAAGG + Intergenic
915387314 1:155507108-155507130 TTTTGTATTTTTAATAGACAGGG - Intronic
916162185 1:161928594-161928616 TTTTGTATATTTAAATGTCATGG - Intronic
916204876 1:162306764-162306786 TTTTGTATAATTAGTAGAGATGG - Intronic
916749262 1:167709489-167709511 TTTTGTATTTGTAATAGAGACGG - Intergenic
916754225 1:167753398-167753420 TTTTCAATAAGAAATTGTCATGG + Intronic
917046176 1:170863267-170863289 TTTTGTATATTTAGTAGACACGG - Intergenic
917517884 1:175722960-175722982 TTTTGTATTTTTAATTGAGACGG + Intronic
917851379 1:179067432-179067454 TTTTGTATTATTAATAGAGACGG - Intronic
918060173 1:181054107-181054129 TTTTGAATAATGAATTTACAAGG - Intronic
918390408 1:184053728-184053750 TTTTTTAAAAGGAATTGACAAGG - Intronic
918923036 1:190740242-190740264 TTTTGAAAAAGTATTGGACATGG + Intergenic
918994805 1:191743461-191743483 TTTTGTTTAAATAACTGAGATGG - Intergenic
919224132 1:194672439-194672461 TTTTGTATAGGTAATTGTAATGG + Intergenic
920152935 1:203923999-203924021 TTTTGTATTTTTAATTGAGATGG + Intergenic
920447890 1:206033742-206033764 TTTTGAATAAGTAATTGTGATGG - Intergenic
920495567 1:206452712-206452734 TTTTGTATTATTAATAGACGGGG - Intronic
921393584 1:214643829-214643851 TTTGGTATAAGTCATTTAAAAGG + Intronic
921531019 1:216283260-216283282 TTTTGTATTTGTAATAGAGATGG + Intronic
921965847 1:221088142-221088164 TTTTTTCTGAGTAATTAACAAGG + Intergenic
922512655 1:226182441-226182463 TTTTGTATTATTAATAGAGATGG - Intronic
922553335 1:226513696-226513718 TTTTGTATAATTAGTAGAGATGG - Intergenic
923183721 1:231549271-231549293 TTTTGTATTTTTAATAGACATGG - Intronic
923298756 1:232620828-232620850 TGTTGTATAATTCAATGACAAGG + Intergenic
923694663 1:236236095-236236117 TTTTGTATTTTTAGTTGACACGG + Intronic
924630624 1:245736907-245736929 TTTTATATAAGTACATGCCAGGG + Intergenic
924760440 1:246979856-246979878 TTTTATATGAGTAATTGGGAAGG - Intronic
924857310 1:247886711-247886733 TTTTGTATATTTAGTTGAGATGG - Intergenic
1062934903 10:1378338-1378360 GTTTGTACAAGTATTTAACAAGG - Intronic
1063273551 10:4538714-4538736 TTTTGTATTTTTAATTGAGATGG - Intergenic
1063808401 10:9675156-9675178 TTTTGTATAAATAAAGTACAGGG - Intergenic
1063996847 10:11627633-11627655 TTTTGTATTTGTAATAGAGACGG + Intergenic
1064009420 10:11723654-11723676 ATTTGTATAAGTTAAAGACAGGG - Intergenic
1064046679 10:12023348-12023370 TTTTGGTTAAGTGATTGACCTGG - Intronic
1064656148 10:17558142-17558164 TTTTGTATTATTAATAGAGACGG - Intergenic
1064803234 10:19099929-19099951 TTTTGTATTTTTAATTGAGATGG + Intronic
1064965238 10:21009251-21009273 TTTTGTATAAGTAAATCGCTTGG + Intronic
1065072315 10:22038556-22038578 TGTTTTATAAATAATTGGCATGG + Intergenic
1065371848 10:24994848-24994870 TTTTGTATATTTAGTAGACAGGG - Intronic
1065585804 10:27216309-27216331 TTTTGTATATTTACTTGAGATGG + Intronic
1066287578 10:33982857-33982879 TTTTGTACATGTTACTGACATGG - Intergenic
1066524279 10:36259234-36259256 TTTTGTATTTGTAATAGAGATGG - Intergenic
1066527876 10:36300881-36300903 TTTTGTATATGTTATAGAAATGG - Intergenic
1067043804 10:42973166-42973188 TATTGCATAAGAAATTTACAAGG - Intergenic
1067115108 10:43429454-43429476 TTTTGTATTTGTAATAGAGACGG - Intergenic
1067345680 10:45437180-45437202 TTTTGTATTTTTAATTGAGACGG - Intronic
1067576729 10:47413842-47413864 TTTTCTAAAAGGAAATGACATGG - Intergenic
1067847257 10:49734341-49734363 TTTTGTATTATTAATAGACGGGG - Intergenic
1067991763 10:51222045-51222067 TTTTGTATTTGTATTAGACACGG + Intronic
1068089371 10:52413664-52413686 TTTTGTATTTTTAATGGACACGG + Intergenic
1068109222 10:52659560-52659582 TTTTGTATTTGTAATAGAGATGG + Intergenic
1068786533 10:60981939-60981961 TTTTGTATTTGTAGTTGAAATGG + Intronic
1069338440 10:67381678-67381700 TGTTGTATATGTAATTTCCATGG - Intronic
1069388474 10:67907113-67907135 TTTTCTATAATTAACTGTCAAGG - Intronic
1069599818 10:69696756-69696778 TTTTGTATATTTAGTAGACACGG - Intergenic
1070023981 10:72613972-72613994 TTTTGTATTTTTAATTGAGACGG - Intronic
1070055398 10:72929711-72929733 TTTTGTATTATTAATAGAGACGG + Intronic
1070235807 10:74624579-74624601 GTTTTTGTAAGTAATTTACATGG + Intronic
1070413893 10:76171307-76171329 TTTTGTATATTTAATAGAGATGG + Intronic
1071975195 10:90948358-90948380 TTTTGTATTTTTAGTTGACAGGG + Intergenic
1072197924 10:93132563-93132585 TTTTGTCTAGGTAATGGAGAAGG + Intergenic
1072241948 10:93504980-93505002 TTTTGTATTATTAATAGAGACGG + Intronic
1072900396 10:99401978-99402000 TTTTGTATTTTTAATAGACACGG + Intronic
1072927976 10:99633523-99633545 TTTTGTATTTGTAGTAGACATGG - Intergenic
1073431457 10:103490104-103490126 TTTTGTATTTTTAATTGAGATGG - Intergenic
1073773563 10:106761806-106761828 ATTTGTATAAGGAATAGAGATGG - Intronic
1074748582 10:116560746-116560768 TTTTGTATTTTTAATTGAGATGG + Intronic
1074823810 10:117200633-117200655 TTTTGTATATTTAGTTGAGACGG - Intronic
1075354796 10:121761844-121761866 TTTTGTAAAAGTTAGTGAAAAGG - Intronic
1075813068 10:125241248-125241270 TTTTTTTTAATTTATTGACATGG - Intergenic
1075829848 10:125399425-125399447 ATTTGGATAAGTACTTGCCAGGG - Intergenic
1075889099 10:125930211-125930233 TTTTGTATATTTAATAGAGATGG + Intronic
1076211559 10:128650337-128650359 TTTTGTATTTGTAATAGAGATGG - Intergenic
1076514937 10:131039605-131039627 TTTTGTATAAATAATACACAAGG + Intergenic
1077041094 11:523458-523480 TTTTGTATTTGTAGTAGACATGG - Intergenic
1077564009 11:3284727-3284749 TTTTGTATTTGTAGTAGACACGG - Intergenic
1077569899 11:3330544-3330566 TTTTGTATTTGTAGTAGACACGG - Intergenic
1077761414 11:5103645-5103667 TTTGGTATCAGTAATTTCCATGG - Intergenic
1078592258 11:12653385-12653407 TTTTGAATATGGAATTGAGAAGG - Intergenic
1079029672 11:16977189-16977211 TTTTGAACAAGGAGTTGACATGG - Intronic
1080122473 11:28693386-28693408 TTTTGTATTTGTAATAGAGATGG - Intergenic
1080166767 11:29246704-29246726 TTATGTATAAGTAATATAAATGG + Intergenic
1080423575 11:32135948-32135970 TTTTGTATTTTTAATTGAGATGG + Intergenic
1080616348 11:33947944-33947966 TTTTGTATTTTTAATTGAGACGG + Intergenic
1080755003 11:35188765-35188787 TTTTGTATTTTTAGTTGACACGG - Intronic
1081568111 11:44272331-44272353 TTTTGTATATTTAATAGAGATGG - Intronic
1081817214 11:45954165-45954187 TTTTGTATTAGTAGTAGAGACGG + Intronic
1081940561 11:46937707-46937729 TTTTGTATACTTAATAGAGACGG + Intronic
1082086420 11:48054101-48054123 TTTTGTATATTTAGTTGAGATGG + Intronic
1082204171 11:49411456-49411478 ATATGTATAACTAATTTACAAGG - Intergenic
1082225725 11:49704561-49704583 TTTTGTAAAAGTTACTAACATGG + Intergenic
1083244106 11:61412459-61412481 TTTTGTATTATTAATAGAGACGG + Intronic
1083845166 11:65327504-65327526 TTTTGTATTTTTAATAGACACGG - Intergenic
1083866583 11:65457785-65457807 TTTTGTATTTTTAATAGACACGG - Intergenic
1084018253 11:66400006-66400028 TTTTGTATTTTTAATTGAGACGG - Intergenic
1084082437 11:66837297-66837319 TTTTGTATTTGTAATAGAGACGG + Intronic
1084295402 11:68210503-68210525 GTTTGTATAAGTCATTGATAGGG - Intronic
1084749017 11:71191727-71191749 TTTTGTATTTGTAATAGAGACGG + Intronic
1084754681 11:71229596-71229618 TTTTGTATTTGTAATAGAGACGG - Intronic
1084847753 11:71913486-71913508 TTTTGTATTAGTAGTAGAGATGG - Intronic
1085249108 11:75130238-75130260 TTTTGTATTTTTAATTGAGATGG - Intronic
1085981194 11:81728480-81728502 TTTTGTATATTTAGTAGACATGG + Intergenic
1086472487 11:87130172-87130194 TTTTTTTTAAGTAAATTACAAGG + Intronic
1086650920 11:89289074-89289096 ATATGTATAACTAATTTACAAGG + Intronic
1086724563 11:90166977-90166999 TTTTGTATTTTTAATAGACACGG - Intronic
1087241203 11:95782731-95782753 TTTTGTTTAAATAATTGTTAAGG - Intronic
1087266613 11:96068654-96068676 TTTTGTATTTTTAGTTGACACGG - Intronic
1087516261 11:99166228-99166250 TTTTGTATATTTAGTAGACATGG - Intronic
1087664270 11:101025190-101025212 TTTCTTGCAAGTAATTGACACGG - Intergenic
1088041821 11:105394871-105394893 TTTGGTAAAAATAAGTGACAAGG + Intergenic
1088326280 11:108604588-108604610 TTTTCTATAAGTAAGTGTCCTGG + Intergenic
1088396116 11:109371592-109371614 TTTAGTAAAAGGAATTGGCAAGG + Intergenic
1088620993 11:111683620-111683642 TTTTGTATAGTTAGTTGAGATGG + Intronic
1088651606 11:111962309-111962331 TTTTGTATTTGTAATAGAGATGG - Intronic
1088936909 11:114411327-114411349 TTTTGTATTTGTAATAGAGACGG + Intronic
1089853378 11:121519116-121519138 TTTTGTATTATTAATAGAGATGG + Intronic
1089956401 11:122575122-122575144 TTTTGTATTTGTAGTTGAGACGG - Intergenic
1091083574 11:132696526-132696548 CTATGTAGAAGTAATTGTCAGGG + Intronic
1092175882 12:6406480-6406502 TTTTGTATAACTTATAGAAATGG + Intergenic
1092682919 12:11007677-11007699 TTTTGTATACGTCTTTGAGATGG + Intronic
1092987495 12:13860493-13860515 TTTTGTATTTTTAATAGACACGG + Intronic
1093194735 12:16116735-16116757 TTTTGTATATTTAATAGAGATGG + Intergenic
1093251884 12:16815834-16815856 TTTTGTATATGTAAAAGATAAGG - Intergenic
1093338687 12:17943351-17943373 TTTAGTAAAAATAATTGACAGGG - Intergenic
1093431243 12:19087689-19087711 TTTTGTATTTGTAATAGAGATGG - Intergenic
1093659026 12:21732825-21732847 ATTTCTATAAGTAATTTACAAGG - Intronic
1093969636 12:25363204-25363226 TTTTGTATTTTTAATTGAGACGG - Intergenic
1094251161 12:28363703-28363725 TTTTGTATTATTAATAGAGACGG - Intronic
1094293232 12:28875185-28875207 TTTTGTTGAAGTAATTGTGATGG - Intergenic
1095456512 12:42391407-42391429 TTTTGTATATGTAGTAGAGATGG + Intronic
1095642973 12:44506060-44506082 TTTTGTAAAGGCAATTTACAGGG + Intergenic
1095933229 12:47650096-47650118 TTTTGTATATTTAGTTGAGATGG + Intergenic
1095999949 12:48120978-48121000 TTTTGTATTTTTAATTGAGACGG - Intronic
1096486608 12:51986428-51986450 TTTTGTATTTGTAATAGAGATGG + Intronic
1097197692 12:57252853-57252875 TTTTGTATTTTTAGTTGACATGG - Intronic
1097205483 12:57317353-57317375 TTTTGTATTTGTAATAGAGATGG + Intronic
1097456134 12:59800916-59800938 TTTTGTATAAGTTATGAAGAAGG - Intergenic
1097561999 12:61219169-61219191 TTTTGAATAAATAAGTGAGAGGG + Intergenic
1097795707 12:63859335-63859357 TTTTGTATAATTAGTAGAGATGG + Intronic
1097942314 12:65324571-65324593 TCTTGTACAAATACTTGACATGG + Intronic
1097991865 12:65843876-65843898 TTTTGTATTATTGATGGACATGG - Intronic
1098276009 12:68811914-68811936 TTTTGTATATTTAATAGAGACGG + Intronic
1098537858 12:71615686-71615708 TTTTGTATTTGTAATAGAGATGG + Intronic
1099149540 12:79092165-79092187 TCTTGGATAAATAATTAACATGG - Intronic
1099650545 12:85422094-85422116 TTTTATATGAGTAATGGATATGG + Intergenic
1099789443 12:87313137-87313159 TTTTTTTTTAGAAATTGACAAGG - Intergenic
1099871183 12:88351194-88351216 TTTTCTTTAAGTAAATGACTAGG - Intergenic
1100253183 12:92853056-92853078 TTTAGCATATGTAATTAACATGG - Intronic
1101385902 12:104257577-104257599 TTTTGTATATTTAATAGAGACGG + Intronic
1101758897 12:107643231-107643253 TTTTGTATTTTTAATAGACAGGG - Intronic
1101864842 12:108513058-108513080 TTTTGTATTTTTAATAGACACGG - Intergenic
1101924760 12:108962267-108962289 TTTTGTATATTTTATAGACATGG + Intronic
1102373412 12:112401337-112401359 TTTTGTATATTTAGTAGACAGGG - Intergenic
1103094786 12:118124060-118124082 TTTTGTATTATTAGTAGACATGG + Intronic
1103282895 12:119775100-119775122 TTTTGTATTTTTAATAGACACGG - Intronic
1103335621 12:120187384-120187406 TTTTGTATTTTTAGTTGACACGG + Intronic
1103380271 12:120488739-120488761 TTTTGTATTTTTAGTTGACATGG - Intronic
1103387621 12:120545707-120545729 TTTTGTATTTTTAATAGACATGG + Intronic
1103628769 12:122242076-122242098 TTTTGTATTTGTAGTAGACATGG + Intronic
1103677407 12:122666940-122666962 TTTTGTATTTGTAATAGAGACGG + Intergenic
1104230853 12:126882709-126882731 TTTTGTATTTGTAATAGAGATGG + Intergenic
1105273710 13:18902197-18902219 TTTTGTATATGTAATAGAGACGG - Intergenic
1105363839 13:19746229-19746251 TTTTGTATTAGTAGTAGAGATGG - Intronic
1105685424 13:22776251-22776273 TTTTGTATAATTGAACGACAGGG - Intergenic
1106202888 13:27556982-27557004 TTTTGAAAAAGTTAATGACAGGG + Intronic
1106266254 13:28112912-28112934 TTTTGTATTTGTAATAGAGAGGG - Intergenic
1107124837 13:36835568-36835590 TTTTGTGTAACTCATTGAAATGG + Intergenic
1107499908 13:40963200-40963222 TAGTGTATAAGTAAAGGACATGG - Intronic
1107527738 13:41249795-41249817 TTTTGTATTTGTAGTAGACATGG + Intronic
1107612984 13:42134804-42134826 TTTTGTATATTTAGTAGACAAGG - Intronic
1108638283 13:52357921-52357943 TTTTGTATTTTTAATAGACACGG - Intergenic
1109103204 13:58213135-58213157 TTTTGTATTTTTAATTGAGACGG - Intergenic
1109432054 13:62249176-62249198 TTTTGTATAAGTTATAAAGAAGG + Intergenic
1109773352 13:67006052-67006074 TTTTGTATATTTAATGGAGACGG - Intronic
1110747548 13:79072417-79072439 TTTTGTATTTTTAATAGACATGG - Intergenic
1110857879 13:80316796-80316818 TTTTGTATTATTAATAGAAACGG + Intergenic
1111255711 13:85665073-85665095 TTTTGTATAATAAGTTTACAGGG + Intergenic
1111323417 13:86660456-86660478 TTTTGTATAGGAAATAGAGAAGG - Intergenic
1111413571 13:87910157-87910179 TTTTGTATTATTAGTAGACACGG - Intergenic
1113599217 13:111556457-111556479 TTTTGTATTTTTAATGGACATGG + Intergenic
1114921919 14:27343094-27343116 ATTTGTATAAGTAAGTAACAAGG + Intergenic
1115085445 14:29509542-29509564 TTTTGTTTCAGTATTTGGCATGG + Intergenic
1115546302 14:34467530-34467552 TTTTGTATTATTAATAGAGATGG - Intergenic
1115554387 14:34532845-34532867 TTTTGTATTTTTAATAGACATGG + Intronic
1116242039 14:42356260-42356282 TTTTGTATTTTTAATTGAGATGG - Intergenic
1116735383 14:48684172-48684194 TTTAGTTTAAGTAATTGAAATGG - Intergenic
1116930984 14:50690749-50690771 TTTCTTATTAGGAATTGACAAGG + Intergenic
1117171318 14:53101001-53101023 TTTTGTGAAAGAAATCGACAAGG - Intronic
1117347246 14:54845305-54845327 TTTTGTATATTTAATAGAGATGG - Intronic
1118205693 14:63721051-63721073 TTTTGTATTTTTAATAGACACGG + Intronic
1118251333 14:64164417-64164439 TTTTGTATAATTAGTAGAGATGG + Intronic
1119730169 14:76946479-76946501 TTTTGTATTTTTAATAGACATGG + Intergenic
1120194665 14:81468626-81468648 TTTTGTATTATTAATAGAGACGG + Intergenic
1120814406 14:88839285-88839307 TCTTGTATTAGTTTTTGACATGG + Intronic
1122021800 14:98843901-98843923 CTTTATATAAGAAATTGCCAGGG + Intergenic
1123726246 15:23105163-23105185 TTTTTTATTAGTAATTGATATGG + Intergenic
1123726262 15:23105392-23105414 TCTTGTATAACTAAGTGACTTGG + Intergenic
1124478930 15:30060748-30060770 TTTTGTATTTGTAATAGAGACGG - Intergenic
1124546995 15:30637988-30638010 TTTTGTATATGTAGTAGAAAGGG + Intronic
1125200721 15:37098934-37098956 TTTTGTCTCTGAAATTGACAAGG - Intronic
1125650443 15:41312798-41312820 TTTTGTATTTGTAATAGAGATGG + Intronic
1125871656 15:43107547-43107569 TTTTGTATCTTTAATAGACATGG - Intronic
1126249192 15:46546805-46546827 TTTAGTATAAGGAATTTACTAGG - Intergenic
1126937462 15:53727139-53727161 TTTTGTATTTTTAATAGACATGG - Intronic
1127037508 15:54934163-54934185 TTTTGTTTAATTAATTAACAAGG + Intergenic
1127129667 15:55849393-55849415 TTTTGTATATTTAATAGAGACGG + Intronic
1127444266 15:59044199-59044221 TTTTGTATTATTAATAGAGACGG + Intronic
1127830568 15:62747212-62747234 TTTAGCACAAGTCATTGACAAGG - Intronic
1127945876 15:63752229-63752251 TGTTTTATGACTAATTGACAAGG - Intronic
1128105249 15:65039565-65039587 TATTGGATAAGTAAATAACATGG - Intergenic
1128239994 15:66095405-66095427 TCTGGTCTAAGGAATTGACAGGG - Intronic
1128834199 15:70795870-70795892 TTTTGTATTATTAATAGAGATGG - Intergenic
1128952706 15:71903785-71903807 TTTTGTATACGGAATTGAAAAGG - Intronic
1129047518 15:72749431-72749453 TTTTGTATTATTAATAGAGATGG - Intergenic
1129337271 15:74860242-74860264 TTTTGTATTTTTAATAGACATGG - Intronic
1129752377 15:78075368-78075390 TTTTGTATATTTAATAGACATGG + Intronic
1129995268 15:79999077-79999099 TTTTGTATTTTTAATAGACATGG - Intergenic
1130998526 15:88919556-88919578 TTTTGTATTTTTAATAGACACGG + Intergenic
1131100661 15:89687092-89687114 TTTTGTATTTTTAATAGACACGG + Intronic
1131361148 15:91791806-91791828 TTTTGTATTTGTAGTAGACAAGG + Intergenic
1131477175 15:92749914-92749936 TTTTGTATATTTAATAGAGATGG + Intronic
1131498126 15:92932911-92932933 TTTTGTATTTTTAATAGACATGG + Intronic
1131524808 15:93144188-93144210 TTTTGTATATTTAATAGAGACGG - Intergenic
1131558757 15:93421569-93421591 TTCTGTATAATTAATTCAGAGGG + Intergenic
1131599923 15:93836877-93836899 TTTTGTATATTTAATAGAGACGG - Intergenic
1133114144 16:3566553-3566575 TTTTGTATATTTAATAGAGATGG - Intronic
1133341453 16:5039126-5039148 TTTTGTATTTTTAATAGACACGG - Intronic
1133489050 16:6249352-6249374 TTTTGTATTATTAATAGACACGG - Intronic
1133773801 16:8883004-8883026 TTTTGTATTTGTAGTTGAGATGG + Intergenic
1134144481 16:11749140-11749162 TTTTGTATTTTTAATAGACATGG + Intergenic
1134306651 16:13039077-13039099 TTTTGTATTTGTAATAGAGACGG + Intronic
1134437176 16:14271004-14271026 TTTTGTATTTTTAATAGACATGG - Intergenic
1134535223 16:15020811-15020833 TTTTGTATATTTAATAGAGACGG - Intronic
1134537859 16:15041107-15041129 TTTTGTAGAATTAAATGACCGGG - Exonic
1134563320 16:15229400-15229422 TTTTGTATAAGGAAGTGAAAGGG + Intergenic
1134923847 16:18141029-18141051 TTTTGTATAAGGAAGTGAAAGGG + Intergenic
1135328367 16:21542269-21542291 TTTTGTATTTGTAATAGAGATGG + Intergenic
1135708061 16:24692135-24692157 TTTTGTACAAGAAATAGACAGGG + Intergenic
1135767585 16:25191213-25191235 TTTTGTATAATTAGTAGAGATGG + Intergenic
1136159010 16:28405534-28405556 TTTTGTATTTGTAATAGAGAAGG + Intergenic
1136204077 16:28709749-28709771 TTTTGTATTTGTAATAGAGAAGG - Intronic
1136351502 16:29711562-29711584 TTTTGTATATTTAATAGAGACGG + Intergenic
1136603638 16:31315627-31315649 TTTTGTATATTTAATAGAGACGG + Intronic
1138722066 16:59093794-59093816 TTTTAAAGAAGTAATGGACATGG - Intergenic
1138759630 16:59526733-59526755 TTTAGCCTAAGTAATTGACCTGG + Intergenic
1138786972 16:59858462-59858484 TTTTCTATAAATGATTGACTGGG + Intergenic
1139707763 16:68753507-68753529 TTTTGTATTTTTAATAGACACGG + Intronic
1139852124 16:69957331-69957353 TTTTGTATTTGTAATAGAGATGG + Intronic
1139881095 16:70180235-70180257 TTTTGTATTTGTAATAGAGATGG + Intronic
1140185622 16:72767823-72767845 TTTTGTAAAAGTAATATACTTGG + Intergenic
1140371410 16:74415283-74415305 TTTTGTATTTGTAATAGAGATGG - Intronic
1140543183 16:75779157-75779179 TTTTGTATCATTAGTAGACATGG + Intergenic
1140642990 16:76998971-76998993 TTTTGTATTAGTAGTAGAGATGG - Intergenic
1140856289 16:78980758-78980780 TTTTGAATAAGTATTTTGCAGGG + Intronic
1141011258 16:80402013-80402035 TTTTGTATTTGTAATAGAGATGG + Intergenic
1141197887 16:81875132-81875154 TTTTGTATTTTTAATTGAAACGG + Intronic
1142929529 17:3271003-3271025 TTTTGTATTATTAATAGAGATGG + Intergenic
1143159289 17:4858645-4858667 TTTTGTATTTGTAATAGAGATGG + Intronic
1143822995 17:9579736-9579758 TTTTGTATTTTTAATAGACACGG + Intronic
1143835422 17:9688519-9688541 TTTTGTATATTTAGTAGACACGG + Intronic
1143895005 17:10128789-10128811 TTTTGTATTTGTAGTAGACATGG + Intronic
1144066791 17:11631471-11631493 TTTTGTATTTTTAATTGAGACGG - Intronic
1144159676 17:12545400-12545422 TCCTGTATCAGTAATTGTCAAGG - Intergenic
1144483740 17:15648051-15648073 TTTTGTATATTTAATAGAGATGG - Intronic
1145892140 17:28424518-28424540 TTTTGTATTTGTAATAGAGATGG - Intergenic
1145967267 17:28928609-28928631 TTTTGTATTTGTAATAGAGATGG - Intronic
1146111902 17:30097361-30097383 TTTTATTAAAGTAATTGAAAAGG + Intronic
1146841424 17:36158320-36158342 TTTTTTAAAAATAGTTGACAAGG + Intergenic
1147058294 17:37851604-37851626 TTTTGTATTTGTAATAGAGATGG + Intergenic
1147355687 17:39894534-39894556 TTTTGTATTTTTAATAGACATGG + Intergenic
1147516905 17:41127126-41127148 TTTTGTATTTTTAATAGACATGG + Intergenic
1147730701 17:42599482-42599504 TTTTGTATTTTTAATAGACATGG - Intronic
1147748512 17:42711301-42711323 TTTTGTATTTGTAATAGAGACGG - Intronic
1147840907 17:43370764-43370786 TTTTGAATTTGTAATTGAGATGG - Intergenic
1148185425 17:45640017-45640039 TTTTGTATGAGTAGTAGAGACGG + Intergenic
1148427328 17:47610552-47610574 TTTTGTATTATTAGTAGACATGG + Intronic
1148436306 17:47688611-47688633 TTTTGTATTAGTAGTAGAGATGG - Intergenic
1148492931 17:48034810-48034832 TTTTGTATAATTAGTAGAGATGG - Intronic
1148534209 17:48424760-48424782 TTTTGTATTTTTAATAGACACGG - Intronic
1149489275 17:57070583-57070605 TTTTGTATTAGTAGTAGAGATGG - Intergenic
1149636911 17:58178364-58178386 TTTTGTATTTGTAATAGAGACGG - Intergenic
1150767825 17:68016169-68016191 TTTTGTATTATTATTAGACACGG + Intergenic
1151299354 17:73211396-73211418 TTTTGTATTTTTAATTGATACGG - Intronic
1151680084 17:75618480-75618502 TTTTGTATTTTTAATAGACATGG - Intergenic
1151774114 17:76186767-76186789 TTTTGTATTTGTAATAGAGATGG - Intronic
1151920405 17:77150518-77150540 TTTTGTATATGAAATTGGAATGG - Intronic
1152395174 17:80028356-80028378 TTTTGTATTTCTAATAGACAGGG - Intronic
1152835713 17:82529556-82529578 TTTTGTATTTTTAATAGACAGGG + Intronic
1152986562 18:326831-326853 TTTTCCATCAGTAATTGAGAGGG + Intronic
1153031536 18:717953-717975 TTTTGTATTTTTAATTGAGAGGG - Intergenic
1155209695 18:23589896-23589918 TTTTGTATTTTTAATTGAGACGG - Intergenic
1156586965 18:38442068-38442090 TTTCCTATAAGTAATGGATATGG + Intergenic
1156620497 18:38845898-38845920 TTTTGTATTTTTAATAGACATGG - Intergenic
1156980228 18:43277738-43277760 TTTTATATTAGGAACTGACAGGG - Intergenic
1157334112 18:46724801-46724823 TTTTGTATATTTAGTAGACATGG - Intronic
1157421811 18:47554156-47554178 TTTTGTATATTTAGTAGACATGG - Intergenic
1157660430 18:49437084-49437106 TTTTGTATCAGTAATATTCATGG + Intronic
1157785407 18:50477439-50477461 TTTTGTATTTTTAATTGAGATGG - Intergenic
1158651508 18:59292009-59292031 TTTTGTATTTTTAATAGACATGG + Intronic
1158714488 18:59865899-59865921 TTTTGTATTAGTACTTGATTTGG + Intergenic
1158913802 18:62098516-62098538 TTTTGTCTAAATGATTGATAAGG + Intronic
1159152512 18:64538246-64538268 TTTTGTATAAATTCTTCACAGGG - Intergenic
1159378065 18:67619976-67619998 GTTTGTATATATAATTTACATGG + Intergenic
1159588335 18:70303620-70303642 TTTTGTATTTTTAATAGACATGG - Intronic
1161098267 19:2406503-2406525 TTTTGTATAATTAGTAGAGATGG + Intronic
1161256360 19:3312133-3312155 TTTTGTATTATTAGTAGACACGG + Intergenic
1162328865 19:10014707-10014729 TTTTGTATTTTTAATAGACAAGG + Intronic
1162422396 19:10573246-10573268 TTTTGTATTTTTAATAGACATGG - Intronic
1162432770 19:10639102-10639124 TTTTGTATATTTAATAGAGATGG + Intronic
1162482235 19:10934675-10934697 TTTTGTATTTTTAATAGACACGG - Intergenic
1163477188 19:17533237-17533259 TTTTGTATTTTTAATTGAGACGG - Intronic
1163918158 19:20260981-20261003 TTTTGTATATTTAATAGAGACGG + Intergenic
1163960142 19:20682467-20682489 TTTTGTATTTGTAGTAGACATGG - Intronic
1164003028 19:21122982-21123004 TTTTGTATTTGTAGTAGACACGG - Exonic
1164631646 19:29765703-29765725 TTTTGTATTATTAATAGAGATGG - Intergenic
1164735517 19:30538191-30538213 TTTTGTATTTCTAAATGACATGG + Intronic
1164999977 19:32752962-32752984 TTTTGTATATTTAATAGAGACGG + Intronic
1165164155 19:33839788-33839810 TTTTGTATAATTAGTAGAGACGG - Intergenic
1165176930 19:33936995-33937017 TTTTTTAAAAATAATTGAGATGG + Intergenic
1166352321 19:42205455-42205477 TTTTGTATTTTTAATAGACAGGG - Intronic
1166831170 19:45640587-45640609 TTTTGTATTATTAATAGACAGGG + Intronic
1166953165 19:46444013-46444035 TTTTGTATTTGTAGTAGACACGG + Intergenic
1166964935 19:46523723-46523745 TTTTGTATATTTAATAGAGACGG - Intronic
1167212502 19:48142129-48142151 TTTTGTATTTGTAATAGAGATGG - Intronic
1167248198 19:48386616-48386638 TTTTGTATTTTTAATAGACAGGG + Intronic
1167440528 19:49506155-49506177 TTTTGTATTTGTAATAGAGATGG + Intergenic
1167832416 19:52036378-52036400 TTTTGTATAAAGAAAAGACAAGG + Intronic
1167862296 19:52295352-52295374 TTTTGTATTTGTAATAGAGATGG + Exonic
1168025718 19:53641981-53642003 TTTTGTATATTTAGTTGAGATGG - Intergenic
1168163321 19:54527741-54527763 TTTTGTATCATTAGTAGACACGG - Intergenic
1168693823 19:58393981-58394003 TTTTTTAGAAATAATTGAGATGG + Intronic
1168695032 19:58399357-58399379 TTTTGTATTTGTAATAGAGACGG + Intergenic
926468177 2:13217241-13217263 TTTTGTATATTTAATAGAGATGG + Intergenic
926745053 2:16149886-16149908 TTTTGTATTTTTAATAGACACGG + Intergenic
927045974 2:19278744-19278766 TTTTGTATAAGGTATAGAGAAGG + Intergenic
927779258 2:25926352-25926374 TTTTGTATATGTAGTAGAGATGG + Intergenic
927790280 2:26004069-26004091 TTTTGTATCTGTAATAGAGACGG - Intergenic
928037923 2:27843313-27843335 TTTTGTATAATGACTTTACAAGG - Intronic
928067945 2:28185584-28185606 TTTTGTATAAGTAATCCCCTTGG + Intronic
928231730 2:29504560-29504582 TTTTGGAGATGGAATTGACAGGG + Intronic
928240958 2:29585625-29585647 TTTTGTAAAAACAATTGACAGGG - Intronic
929012866 2:37463333-37463355 CTTTTTAAAAGAAATTGACAGGG - Intergenic
929156983 2:38797193-38797215 TTTTGTATTTTTAATTGAGATGG + Intergenic
929376858 2:41298095-41298117 TGTTGTATAAATATTTTACAGGG + Intergenic
930437062 2:51358446-51358468 TTTGGAAGAAGCAATTGACATGG - Intergenic
930471390 2:51819567-51819589 TTTTAAAAAAGTAATTGAGAAGG - Intergenic
930729715 2:54716229-54716251 TTTTGTATATTTAATAGAGATGG + Intergenic
931227772 2:60348735-60348757 TTTTTAATAAGTAATTTTCAGGG + Intergenic
931922555 2:67037093-67037115 TTTTGTATTATTAGTTGAGATGG + Intergenic
932535259 2:72586069-72586091 TTTTGTATATGTGAAAGACAGGG - Intronic
932561533 2:72875653-72875675 TCTTGAATAAGTACATGACAAGG + Intergenic
933162003 2:79035794-79035816 TTTTGTATTATTAACAGACACGG - Intergenic
933338226 2:80987185-80987207 TTTTATATATCCAATTGACAGGG + Intergenic
933905697 2:86890399-86890421 TTTTGTATTTGTAGTAGACATGG - Intergenic
933960035 2:87402298-87402320 TTTTGTATATTTAGTAGACACGG - Intergenic
934463675 2:94239173-94239195 TTTAGTATAAGCCATTGATAAGG + Intergenic
935044469 2:99467873-99467895 TTTTGTATTTTTAATAGACATGG - Intronic
935766537 2:106373566-106373588 TTTTGTATTTGTAGTAGACATGG - Intergenic
936366465 2:111861244-111861266 TTTTGTATTTGTAGTAGACATGG + Intronic
936379348 2:111970325-111970347 TTTTGTATATTTACTAGACATGG + Intronic
937510911 2:122594058-122594080 TTTTGTATAAGTCAGGGATAGGG + Intergenic
937642218 2:124226663-124226685 TCTTGTATAAGAAACTGAAATGG - Intronic
937902946 2:127036458-127036480 TTTTGTATTTTTAATAGACATGG - Intergenic
937903024 2:127037096-127037118 TTTTATTTAACTAATTAACAAGG - Intergenic
938367709 2:130747962-130747984 TTTTGTATTTGTAGTAGACATGG + Intergenic
938638288 2:133252605-133252627 TTTTGTCTAAATCAGTGACAGGG - Intronic
938787575 2:134646613-134646635 TTTTGTATTATTAATAGAGATGG + Intronic
939262161 2:139824087-139824109 TTTTGTATTTTTAATAGACACGG + Intergenic
939383687 2:141468190-141468212 TTTTGCATAATTAATTTAGATGG + Intronic
939574869 2:143883717-143883739 TGTTGAATAAGTGAATGACAAGG + Intergenic
940782521 2:157947879-157947901 ATTTGAATAAGGAATTGAAAAGG - Intronic
940966226 2:159839833-159839855 TTTTGTATTTGTAATAGAGATGG - Intronic
941026181 2:160458624-160458646 TTTTGTATCATTAGTAGACATGG - Intronic
941315404 2:163985854-163985876 TTTTGTATTTTTAGTTGACACGG + Intergenic
941438194 2:165498083-165498105 CTTTCTGTAAGTAAGTGACAGGG + Intronic
941692975 2:168520778-168520800 TTTTGTATTATTAATAGAGAAGG + Intronic
942804061 2:179909122-179909144 TTTTTAAAAAGTTATTGACAAGG + Intergenic
942846509 2:180432577-180432599 TTTTGTATTTTTAATTGAGATGG + Intergenic
942994022 2:182238481-182238503 ATTTGGGTAAGTAATTGCCAGGG + Intronic
943422193 2:187679961-187679983 TTTTGTATTGGTAAATTACAGGG + Intergenic
943434005 2:187840677-187840699 TTTTGTATTTGTAATAGAGACGG + Intergenic
943930448 2:193844620-193844642 TTTTGTATAATAGATTAACATGG - Intergenic
944421222 2:199532707-199532729 TTATTTATACATAATTGACATGG - Intergenic
944732718 2:202533650-202533672 TTTTGTATTATTAGTAGACATGG - Intronic
944842074 2:203634292-203634314 TTTTGTATATTTAGTAGACATGG - Intergenic
945572941 2:211493204-211493226 TATGGTATAAATAATTGAGAGGG - Intronic
945738768 2:213635205-213635227 TTTTGTATTTGTAATAGAGATGG + Intronic
947620232 2:231585381-231585403 TTTTGTATTTTTAGTTGACATGG - Intergenic
947627595 2:231630027-231630049 TTTTGTATTCTTAATAGACACGG - Intergenic
948094499 2:235322699-235322721 TTTTGTATTTTTAATAGACATGG - Intergenic
1169222468 20:3833084-3833106 TTTTGTATTTTTAATAGACACGG + Intergenic
1170006474 20:11675332-11675354 TTATGGATACTTAATTGACATGG - Intergenic
1170225176 20:13984180-13984202 TTTTGTATATTTAGTAGACATGG + Intronic
1170827671 20:19810226-19810248 TTTTGTATTATTAATAGAGACGG - Intergenic
1171489664 20:25508169-25508191 TTTTGTCTCAGTAAATGTCAGGG - Intronic
1172086340 20:32386586-32386608 TTTTGTATAATTATTAGAGATGG + Intronic
1172147307 20:32765589-32765611 TTTTGTATTTTTAATTGAGACGG + Intronic
1172494885 20:35373506-35373528 TTTTGTATTTTTAGTTGACATGG - Intronic
1172800425 20:37572607-37572629 TTTTGTATTACTAATAGAGATGG + Intergenic
1173183751 20:40823366-40823388 TGTTGTATAAATTAATGACAAGG - Intergenic
1173548290 20:43915328-43915350 TTGTGTATAAGTGACTGTCAGGG - Intronic
1174014298 20:47475296-47475318 TTTTGTATTTTTAATAGACATGG - Intergenic
1174182209 20:48681979-48682001 TTTTGAATATGGAAATGACATGG - Intronic
1174223098 20:48973215-48973237 TTTTGGATAAATCATTTACAAGG - Exonic
1174614700 20:51826772-51826794 TTTTGTATTTTTAATAGACAAGG - Intergenic
1175072316 20:56344863-56344885 TTTTGTATTTGTAATAGAGATGG + Intergenic
1175350907 20:58317265-58317287 TTTTGTATTATTAGTTGAGATGG + Intronic
1177323737 21:19556545-19556567 TTTTTTTTAAGTAAATTACATGG - Intergenic
1177501530 21:21962979-21963001 TTTTGTATTATTAATAGAGACGG - Intergenic
1177506636 21:22027796-22027818 TTTTGTATTTTTAATTGACATGG - Intergenic
1177580305 21:23013752-23013774 TTTTGTATAAGCAATTTGCTTGG + Intergenic
1177677569 21:24321521-24321543 TTTTTAATAAATAATTGAAAAGG - Intergenic
1177677572 21:24321570-24321592 TTTTTAATAAATAATTGAAAAGG + Intergenic
1177684804 21:24422073-24422095 TTTTGACTATGTAATTGACATGG - Intergenic
1178090567 21:29158850-29158872 TTTTCTATATATAATTGAAAAGG + Intronic
1179193938 21:39147552-39147574 TTTTGTATTTTTAATTGAGAGGG + Intergenic
1180918209 22:19504467-19504489 TTTTGTATTTGTAATAGAGACGG + Intronic
1181183964 22:21088260-21088282 TTTTGTATTTTTAATAGACACGG + Intergenic
1182618227 22:31603059-31603081 TTTTGTATTATTAATAGAGAGGG - Intronic
1183186911 22:36297065-36297087 TTTTGTATAAGTAATTGACACGG - Intronic
1183405193 22:37626989-37627011 TTTTGTATTTTTAATAGACATGG - Intronic
1183874432 22:40766882-40766904 TTTTTTTTAAGTAATTGAGACGG + Intergenic
1183908417 22:41060532-41060554 TTTTTTAAAAGAAATAGACATGG - Intergenic
1184553008 22:45215045-45215067 TTTTGTATTTTTAATAGACATGG - Intronic
1184592481 22:45494369-45494391 TTTTGTATTTTTAATAGACACGG + Intergenic
1185115022 22:48929023-48929045 TTTTCTGTAGGTAATTCACAGGG + Intergenic
949210242 3:1490551-1490573 TTGTGTATAATTAATTACCAGGG + Intergenic
949513884 3:4789788-4789810 TTTTGTATTTGTAATAGAGATGG + Intronic
949735557 3:7167795-7167817 TTTTGTATATTTAGTTGAGACGG - Intronic
949798372 3:7876527-7876549 TTTTGTAGAAATAAATCACATGG + Intergenic
950067003 3:10120363-10120385 TTTTGTATTAGTAGTAGAGATGG + Intronic
950070747 3:10150255-10150277 GTTTGTATAAGTAATTCAGTGGG + Exonic
950320752 3:12050514-12050536 TTTTGTATTATTAGTAGACATGG + Intronic
950813627 3:15674724-15674746 TTTTGTAAAAGAAATTAAGAAGG + Intronic
950897368 3:16465633-16465655 TTTAGCATCCGTAATTGACATGG - Intronic
951280787 3:20746577-20746599 TTTTGTATTTTTAATAGACATGG + Intergenic
951337652 3:21444250-21444272 TTTTGTATTTTTAATAGACATGG + Intronic
951490446 3:23265124-23265146 TTTTGTTTAAGGAATTGAAGAGG + Intronic
951534598 3:23729400-23729422 TTTTGTATTTGTAATAGAGATGG + Intergenic
952428074 3:33195434-33195456 TGTTGTGCAGGTAATTGACAAGG + Intronic
952461856 3:33535776-33535798 TTTTGTATCTTTAACTGACATGG - Intronic
952612065 3:35223591-35223613 TTTTGAGTAGGTAAGTGACAGGG + Intergenic
952617526 3:35292802-35292824 TTGTGTATGAGTGATTGCCAGGG - Intergenic
952916496 3:38249164-38249186 TTTTATATAAATAATGGAGAGGG - Intronic
953295049 3:41706655-41706677 TTTTGTATTTTTAATTGAGACGG - Intronic
953299543 3:41758419-41758441 TCTTGTATAACTAAGTGACTTGG - Intronic
953299607 3:41758937-41758959 TTTTTTATTAGTAATTGATATGG - Intronic
953466773 3:43128697-43128719 TTGTTTATAATTAATTCACATGG + Intergenic
954001510 3:47561036-47561058 TTTTGTATTTTTAATAGACACGG + Intergenic
954016025 3:47691827-47691849 TTTTGTATTATTAGTAGACATGG - Intronic
954045975 3:47930752-47930774 TTTTGTATTTGTAGTAGACAGGG - Intronic
954310709 3:49764706-49764728 TTTTGTATTTGTAGTAGACATGG - Intronic
955292638 3:57706783-57706805 TTTTATATAAGCACTTGGCATGG - Intergenic
955323725 3:57993655-57993677 TTTTGTATTATTAATAGAGATGG - Intergenic
955420597 3:58733159-58733181 TTTTGTATTTTTAGTTGACACGG - Intronic
955691026 3:61590937-61590959 TTTTGTATTTTTAATAGACATGG - Intronic
955861590 3:63335944-63335966 TTTTGTATTTGTAATAGAGACGG + Intronic
956615860 3:71171961-71171983 TTTTTAATAAATAATTGATAAGG - Intronic
956764757 3:72475073-72475095 TTTTGTATTTTTAATAGACATGG + Intergenic
957355254 3:79075191-79075213 TTCTATATAAATATTTGACAAGG - Intronic
957581605 3:82080043-82080065 TTTTTTTTAAATAATTGACTGGG + Intergenic
959036746 3:101375370-101375392 TTTTGTATTAGTAGTAGAGACGG - Intronic
959511315 3:107215948-107215970 TGTTGTTTAAGAAATTGCCATGG + Intergenic
959708699 3:109362787-109362809 TTTTGTATTTTTAATAGACACGG + Intergenic
959790220 3:110351498-110351520 TTTTGTATTATTAATAGAGATGG + Intergenic
960041967 3:113159177-113159199 CTGTGTATAAGGAATTGACAAGG - Intergenic
960104052 3:113774935-113774957 TTTTCTAGAAGTATTTCACAAGG - Intronic
960352764 3:116613000-116613022 TTTTTTTTAAGTAAGTGAGAGGG - Intronic
961915646 3:130371300-130371322 TTTTTTTTCAGAAATTGACAAGG + Intronic
962626235 3:137228430-137228452 CTTTGTTTAAGTAATCCACATGG - Intergenic
962817261 3:139013166-139013188 TTTTGTATAAGAAATTACCATGG + Intronic
963027269 3:140932458-140932480 TTTAGAATAAGTAAGTGACTTGG - Intergenic
963593950 3:147301575-147301597 TTTTGTATTTGTAGTAGACATGG - Intergenic
963741352 3:149085316-149085338 TTTTGTATTTGTAGTAGACAGGG - Intronic
966345525 3:178974759-178974781 TTTTGTATTTTTAATAGACAGGG - Intergenic
966410796 3:179644019-179644041 TTTTGTATTTTTAATAGACATGG - Intergenic
966534204 3:181013089-181013111 TATTTTATATGTAATTGAAAAGG + Intergenic
966602941 3:181793716-181793738 TTTTGTATTTTTAGTTGACATGG - Intergenic
967048922 3:185764150-185764172 TATTATATAAGTAATTGGAAAGG + Intronic
967340982 3:188397782-188397804 TTTTGTATTTGTAGTTGAGAAGG + Intronic
967600829 3:191386393-191386415 TTTTGTATACTTAGTAGACATGG + Intronic
967698845 3:192568001-192568023 TTTTGTATATTTAATAGAGATGG + Intronic
968387752 4:157773-157795 TTTTGTATGAGCTATTGAGAAGG + Intronic
971013159 4:22461276-22461298 TTTTATATAAGTAGCTGAGAAGG - Intronic
971862498 4:32125982-32126004 TTTTGTATAAGTAAGTGTTTGGG + Intergenic
972034482 4:34504347-34504369 TTTTGTATATATAATAGAGATGG + Intergenic
972424785 4:38922110-38922132 TTTTGTATTTGTAATAGAGACGG + Intronic
972959017 4:44429249-44429271 TTTTGTACAAGTATTGGACAAGG + Intronic
973036385 4:45412681-45412703 TTTTTCATAAGTAGTTGACTAGG - Intergenic
973618577 4:52705101-52705123 TTTTGTATTTTTAATTGAGACGG - Intergenic
973953706 4:56042149-56042171 ATTTGTAGAAGAAATTGAAAAGG - Intergenic
974075193 4:57162216-57162238 TTTTTTATATATAATTGAGATGG - Intergenic
974301811 4:60078680-60078702 TTTTGTATTTGTAATAGAGATGG - Intergenic
974571317 4:63652840-63652862 TTTAGTATATATAAGTGACATGG + Intergenic
974680586 4:65155999-65156021 TTTTGTATAAGAATTTCAGAAGG + Intergenic
976095128 4:81500513-81500535 TTTTGTATTAGTAGTAGAGACGG + Intronic
976520021 4:86016084-86016106 TTTTGTTGAAGGAATTCACATGG + Intronic
977221273 4:94340509-94340531 TTTTGTATATTTAATAGAGATGG + Intronic
977566785 4:98588430-98588452 TTTTTTAGAAGTAATAGACTTGG - Intronic
977787765 4:101058698-101058720 TTTCATGTAAGTAATTGAGATGG + Intronic
978787890 4:112630345-112630367 TTTTGTATTTTTAATAGACACGG - Intronic
979068934 4:116176347-116176369 TTTTGCAGAATCAATTGACATGG - Intergenic
979454913 4:120916214-120916236 TTTTGTATTTTTAATAGACAGGG - Intronic
979501942 4:121450769-121450791 ATTTGTATAAATAATCGAGAAGG + Intergenic
979750993 4:124278343-124278365 TTTTGTATTTTTAATTGAGACGG - Intergenic
980217100 4:129866698-129866720 TTTTGTATTTGTAATAGAGACGG + Intergenic
980588170 4:134847381-134847403 TTTTGTATTTGTAATAGAGACGG - Intergenic
980908732 4:138974789-138974811 TTTTGTATTTTTAATAGACAGGG - Intergenic
981255635 4:142657775-142657797 TTTTGGAAAAATAAATGACATGG + Intronic
982004437 4:151050374-151050396 TTTTTTTTAAATAATTGAAATGG + Intergenic
982240802 4:153297525-153297547 TTTTGTACATGTAATTGTTAAGG + Intronic
982746915 4:159113568-159113590 TTTTGTATATGTAGTAGAGAAGG - Intronic
982793508 4:159619097-159619119 TTTTGTATTACTAAATGAAATGG - Intergenic
982891025 4:160850149-160850171 TTGGGTAGAAGTATTTGACAGGG + Intergenic
983358790 4:166701554-166701576 TTTTGTATTATTAGTTGAGACGG - Intergenic
983585435 4:169349130-169349152 TTTTGTCAAAGGAATGGACAAGG + Intergenic
983764993 4:171468506-171468528 TTTTGTGAAAGTAATTTTCAAGG - Intergenic
984000423 4:174234915-174234937 TTTTGTATTATTAATAGAGATGG - Intergenic
984752556 4:183292187-183292209 TTTTTCATAACTGATTGACAGGG - Intronic
984767553 4:183410972-183410994 TTTTGTATTTTTAATAGACATGG - Intergenic
985351924 4:189072953-189072975 TTTTGTATAATACAATGACAAGG + Intergenic
985429292 4:189862950-189862972 TTTTGTATATTTAGTAGACATGG + Intergenic
986416613 5:7535211-7535233 TTTTGTATTATTAATAGAGACGG + Intronic
986564791 5:9101230-9101252 TATTTGATAAGTAATTGAAAAGG - Intronic
986971182 5:13338997-13339019 TTTTGTATATGTAAATAAGATGG + Intergenic
987163591 5:15171026-15171048 TTTTGTATTTGTAATAGAGAAGG - Intergenic
987495318 5:18635854-18635876 TTTTGTATTTGTAATAGAGATGG - Intergenic
987573731 5:19700489-19700511 TTTTGTTTAAGTTATTTAAATGG + Intronic
987660119 5:20861538-20861560 TTTTGTATTTTTAATAGACATGG + Intergenic
987754080 5:22077565-22077587 TTTTGTAAAAGATATTGCCATGG - Intronic
987770522 5:22297189-22297211 TTTTGTATTTTTAATGGACACGG + Intronic
988012923 5:25513663-25513685 TTTTGTATTTTTAATAGACATGG - Intergenic
988153000 5:27411780-27411802 TTTTGTATTATTAATAGAGATGG + Intergenic
988401200 5:30762603-30762625 TTTTGTATTTCTAATAGACATGG - Intergenic
988491162 5:31706671-31706693 TTTTGTATTTGTAATAGAGACGG - Intronic
988763527 5:34344130-34344152 TTTTGTATTTTTAATAGACATGG - Intergenic
989274886 5:39576452-39576474 TTTTGTATATTTAGTAGACACGG - Intergenic
989729904 5:44636535-44636557 TTTTGTATTTGTAGTAGACATGG + Intergenic
990054663 5:51557522-51557544 TTTTGTTTAAGCAATTAACCAGG - Intergenic
990192685 5:53277971-53277993 TTTAGTATTAGCAATTGAGATGG - Intergenic
990413440 5:55563638-55563660 TTTTGTATTTGTAATAGAGATGG - Intergenic
990471311 5:56118451-56118473 TTTTGTATTATTAGTAGACACGG - Intronic
990678151 5:58211953-58211975 TTTTGTATTTTTAATAGACACGG - Intergenic
990920442 5:60959925-60959947 ATTTGTATAAGTAAGGGAGAAGG - Intronic
991069772 5:62463992-62464014 TTTTGTATTTGTAATAGAGACGG + Intronic
991904957 5:71500495-71500517 TTTTGTATATTTAATAGAAACGG + Intronic
992660815 5:78958987-78959009 TTTTGTCTATGTAAGTGATATGG + Intronic
993069953 5:83147956-83147978 TTTTGTATTATTAATAGAGATGG + Intronic
993991364 5:94661705-94661727 TTTTGTATATTTAATAGAGACGG + Intronic
994435465 5:99725278-99725300 TTTTTTCTAACTACTTGACATGG - Intergenic
994536177 5:101032173-101032195 TTTTGTTTTAGTATTTGAAAGGG + Intergenic
994930546 5:106177777-106177799 TTTTGTATATTTAGTTGAGATGG + Intergenic
995050238 5:107694961-107694983 TTGTGTATAGGTAACTGATATGG - Intergenic
995056976 5:107770318-107770340 TTTGGTAAGAGTAATTTACATGG + Intergenic
995686084 5:114773601-114773623 TTGTCTATAAGGCATTGACAAGG + Intergenic
995973513 5:118002936-118002958 TTTGGCATAATTAATTGAGATGG - Intergenic
996034870 5:118747415-118747437 TTTTGTATTTGTAATAGAGAGGG - Intergenic
996374500 5:122790289-122790311 TTTTGTATATTTAATAGAGACGG + Intronic
996864328 5:128102789-128102811 TTTTGTATTATTTATTGAAATGG + Intronic
997125347 5:131221054-131221076 TTTTGTATTATTAATAGAGATGG + Intergenic
997258897 5:132450244-132450266 TTTTGTATTTGTAATAGAGATGG + Intronic
997327760 5:133036152-133036174 TTTTGTATTATTAATAGAGATGG + Intergenic
997468078 5:134101417-134101439 TTTTGTATTTTTAATAGACATGG - Intergenic
998300218 5:141010764-141010786 TTTTGCATAAGTATTGGAAAAGG - Exonic
998734524 5:145120778-145120800 TCTAGAATCAGTAATTGACATGG + Intergenic
999230519 5:150059212-150059234 TTTTGTATATTTAATAGAGACGG + Intronic
999781176 5:154851707-154851729 TTTTGTATATGTAGTAGAAATGG - Intronic
1000110388 5:158102711-158102733 TTTCTTATAAGTAATTTAGAAGG - Intergenic
1000502632 5:162070116-162070138 CTTTGTATAAGACATTGAAATGG - Intronic
1000710933 5:164577142-164577164 TATTGTATTAGCAATTGACAAGG + Intergenic
1000819065 5:165960824-165960846 TTTTGTATTATTAATAGAGATGG + Intergenic
1000884008 5:166730276-166730298 TTTGTAATAGGTAATTGACATGG + Intergenic
1000949688 5:167465655-167465677 TTTTGTATTATTAGTAGACACGG - Intronic
1001392849 5:171394342-171394364 TTTTGTATTTTTAATAGACATGG + Intronic
1001554511 5:172626718-172626740 TTTTGTATTATTAATAGAGATGG - Intergenic
1001811711 5:174634021-174634043 TTTTGTATTTTTAATAGACACGG + Intergenic
1001991791 5:176122872-176122894 TTGTGTATAAGAAATAGAGATGG + Intronic
1002206429 5:177565965-177565987 TTTTGTATTTGTAATAGAGACGG + Intergenic
1002225083 5:177715280-177715302 TTGTGTATAAGAAATAGAGATGG - Intronic
1002394120 5:178940329-178940351 TTTTGAATAGGTAATTTGCATGG - Intergenic
1002608078 5:180395105-180395127 TTTTGTATAATTAGTAGAGACGG - Intergenic
1002620068 5:180481881-180481903 TTTTGTATATTTAGTTGAGATGG + Intergenic
1003576664 6:7302962-7302984 TTTTGTATTTTTAATAGACAGGG - Intronic
1003685498 6:8298212-8298234 TTTTGTATTTTTAATAGACATGG + Intergenic
1003815415 6:9834917-9834939 TTACGTATAAGTATTTGAGATGG - Intronic
1004094364 6:12538339-12538361 TTTTGTATTTTTAATTGAGATGG + Intergenic
1004240084 6:13913268-13913290 TTATGTATAATTATTTGACGTGG - Intergenic
1004754117 6:18593256-18593278 TTTTGTATTTTTAGTTGACATGG + Intergenic
1005061235 6:21778820-21778842 TTTTGTCTAGGTTATTGAAAGGG + Intergenic
1005287653 6:24346006-24346028 TTTTGTATTATTAGTTGAGATGG - Intronic
1005366127 6:25079157-25079179 TTTTGTATATTTAATAGAGATGG - Intergenic
1005618766 6:27600787-27600809 TTTTGTATTTGTAATAGAGACGG - Intergenic
1006515192 6:34541743-34541765 TGTTGAATAAGTAAATGGCAGGG + Intronic
1006536374 6:34702331-34702353 TTTTGTCTCACTAGTTGACAGGG - Intergenic
1006763366 6:36483381-36483403 TTTTGTATTATTAATAGAAACGG + Intronic
1007006475 6:38368503-38368525 TTTTGTATTATTAATAGAGATGG + Intronic
1007099176 6:39232782-39232804 TTTTGTATATTTAATAGAGATGG + Intergenic
1007862481 6:44927479-44927501 ATTTGCATAAGTTATTGAAAAGG - Intronic
1007865148 6:44960234-44960256 TTTTGTATTTTTAATAGACACGG - Intronic
1007929857 6:45680371-45680393 TTTTGTATATTTAATAGAGACGG - Intergenic
1008023314 6:46604820-46604842 TTATGTTTAAGTAATTGCAAAGG - Intronic
1008061565 6:47002976-47002998 TTTTTCTTAAGTAATGGACAAGG - Intronic
1009358992 6:62791250-62791272 TTACGTTTAAGTAATTGATATGG - Intergenic
1009436617 6:63625976-63625998 TTTTGTATTATTAGTAGACACGG - Intergenic
1009443181 6:63706923-63706945 GTTTCTGAAAGTAATTGACAGGG + Intronic
1009835976 6:69002387-69002409 TTTTGTATTTTTAATAGACAAGG + Intronic
1009884561 6:69610494-69610516 TTGTGTATACATAATTGATATGG + Intergenic
1009897005 6:69764093-69764115 TTTTGCATAGGAAATGGACATGG + Intronic
1010216502 6:73407287-73407309 TTTTGTATATTTAGTTGAGATGG + Intronic
1010382671 6:75242647-75242669 TTTTGTATTATTAATAGAGACGG - Intronic
1011012642 6:82719392-82719414 TTTTGGCTTAGGAATTGACATGG - Intergenic
1011532025 6:88333281-88333303 TTTTGTATATGTGAGAGACAGGG - Intergenic
1011669143 6:89665534-89665556 TTTTGTATATGTAGTAGAGACGG - Intronic
1011992559 6:93541251-93541273 TTTTGTATAAGTTATAAAGAAGG - Intergenic
1012239837 6:96859511-96859533 TTTTGTCAAAGTCATTCACAAGG - Intergenic
1012246580 6:96932992-96933014 TTCTGTATATGTAACTGCCAAGG + Intronic
1012612466 6:101232492-101232514 TTCAGTATAAGTAGTTGACTTGG - Intergenic
1013413909 6:109907518-109907540 TTTTTTTTAAATAATTGACTTGG + Intergenic
1013623866 6:111918141-111918163 TTTACTATAGGTAATTTACATGG + Intergenic
1013924383 6:115450809-115450831 TTTTGTATATTTAATAGAGATGG + Intergenic
1014072177 6:117195417-117195439 TTTTCTTTAAATAAATGACAGGG - Intergenic
1014664433 6:124219446-124219468 TTTTGTATTTTTAGTTGACATGG + Intronic
1014683278 6:124461481-124461503 TTTTCTAAAAGTAATTAAGAAGG - Intronic
1014796616 6:125732162-125732184 CTTAGTAGAAGTAATTTACATGG + Intergenic
1014858426 6:126431892-126431914 TTTTGTATATTTAATAGAGATGG - Intergenic
1015415800 6:132946790-132946812 TTTTATAAATGTAATTGAAAAGG - Intergenic
1015514666 6:134072074-134072096 TTTTGGAGAATTGATTGACAGGG + Intergenic
1015744868 6:136499088-136499110 TTTTGTATTATTAGTAGACATGG + Intronic
1015975505 6:138786500-138786522 TTTTGAATAAGTAAATGTGAGGG + Intronic
1016699653 6:147039602-147039624 TTTTGTATTTGTAGTAGACACGG + Intergenic
1017244644 6:152209577-152209599 TTTTGTATTTGTAATAGAGATGG - Intronic
1017408589 6:154146227-154146249 TTTTGTATATTTAATAGAGATGG - Intronic
1017489139 6:154929059-154929081 TTTTGTATTATTAGTAGACACGG - Intronic
1017490358 6:154939627-154939649 TTTTGTAAAAATAATAGAGATGG + Intronic
1018324816 6:162654928-162654950 TTTTTTTTAAGTAAATGATATGG - Intronic
1018418578 6:163622373-163622395 TTGTGTATAAGTAACTGGTAAGG - Intergenic
1018517582 6:164602666-164602688 TTTTGTATTTGTAATAGAGAAGG - Intergenic
1018541410 6:164883833-164883855 TTTTGTATTATTAGTAGACATGG - Intergenic
1019367056 7:638905-638927 TTTTGTATTTGTAATAGAGACGG - Intronic
1020138755 7:5600829-5600851 TTTTGTATTATTAATAGAGACGG + Intronic
1020671153 7:11114430-11114452 TTCTATAAAAGTAATAGACAGGG - Intronic
1020820039 7:12955829-12955851 TTTTGTATTTTTAATAGACAAGG - Intergenic
1021003608 7:15365097-15365119 CTTTTTACAGGTAATTGACAAGG + Intronic
1022306277 7:29149362-29149384 TTTTGTATTTGTAGTAGACACGG + Intronic
1022895503 7:34746952-34746974 TTTTGTATTTTTAATAGACACGG - Intronic
1024220038 7:47280033-47280055 TTTTTTAAAAGAAATTGGCATGG + Intronic
1024783454 7:52878482-52878504 TTTTGTATAAGAAACTTACTAGG - Intergenic
1024785544 7:52903153-52903175 CTTTGTCTCAGTAATTGACATGG - Intergenic
1024850078 7:53703049-53703071 TTTTGTATATTTAATAGAGATGG + Intergenic
1025038805 7:55621136-55621158 TTTTGTATTATTAATAGAGACGG - Intergenic
1026047279 7:66915339-66915361 TTTTGTATTTTTAATAGACACGG + Intergenic
1026163013 7:67887134-67887156 TTTTGTATTACTAATAGAGATGG + Intergenic
1026569076 7:71513759-71513781 TTTAGTAAGAGAAATTGACATGG + Intronic
1026798580 7:73382248-73382270 TTTTGTATATTTAGTAGACATGG + Intergenic
1026812094 7:73476442-73476464 TGTTGTAAAATTGATTGACAAGG - Intronic
1026857712 7:73765879-73765901 TTTTGTATTAGTAGTAGAGACGG - Intergenic
1027056213 7:75051581-75051603 TTTTGTATTTTTAATAGACATGG + Intronic
1027554165 7:79642572-79642594 TTTTGTATTTGTAGTAGACACGG - Intergenic
1027678911 7:81194486-81194508 TACTGTAAAAATAATTGACAGGG - Intronic
1027725744 7:81803700-81803722 TTTTGAATAAGTAGCTGAAAAGG + Intergenic
1028280880 7:88926414-88926436 TTTTGTATTTTTAATAGACATGG - Intronic
1028566103 7:92232863-92232885 TTTTGTATATTTAATAGAGACGG + Intronic
1029136664 7:98377646-98377668 TTTTGTATATTTAATAGAAATGG - Intronic
1029239196 7:99146539-99146561 TTTTGTATTTTTAGTTGACAGGG - Intergenic
1029630791 7:101748803-101748825 TTTTGTATATTTAATAGAGATGG + Intergenic
1029800148 7:102938350-102938372 TTTTGTATATGCAATAAACAGGG + Intronic
1030015082 7:105211250-105211272 TTTTTTTTAAATAATTGAAATGG + Intronic
1030028049 7:105343931-105343953 TTTTGTATTATTAATAGAGACGG + Intronic
1030031440 7:105373571-105373593 TTTTGTATTTTTAATAGACATGG + Intronic
1030723896 7:112902229-112902251 TTTTGTATATTTAGTAGACACGG - Intronic
1030967223 7:116007082-116007104 TTTTGTATATGTAATTGTATTGG - Intronic
1031176260 7:118355608-118355630 TGTTCTATCAGTTATTGACATGG + Intergenic
1031271761 7:119658622-119658644 TTGTGAATAATTAATTAACATGG + Intergenic
1032224697 7:130022000-130022022 TTTTGTATTTTTAATAGACAGGG - Intronic
1032866739 7:135933332-135933354 TTAAGTATAAGAAATTGAGAAGG - Intronic
1034108362 7:148511682-148511704 TTTTGTATATTTCATTGAGACGG + Intergenic
1034151818 7:148922724-148922746 TTTTGTATATTTAATAGAGACGG - Intergenic
1035064108 7:156092885-156092907 TTTTGTATTTTTAATAGACACGG + Intergenic
1035192692 7:157185604-157185626 TTTTATATAATTAAGTGCCAGGG - Intronic
1035592779 8:829836-829858 TTTTGAATATTTGATTGACAAGG - Intergenic
1036044622 8:5125736-5125758 TTTTTAACTAGTAATTGACAGGG + Intergenic
1036080998 8:5555396-5555418 TTTTGTATTATTAATAGAGACGG + Intergenic
1036087856 8:5632995-5633017 TTTTGTATTATTAGTAGACACGG + Intergenic
1036496239 8:9272325-9272347 TTTTGTATTTGTAATAGAGATGG - Intergenic
1037496493 8:19446002-19446024 TTTTGTATTTTTAATAGACATGG - Intronic
1037968103 8:23149407-23149429 TTTTGTATTCTTAGTTGACACGG + Intronic
1038079616 8:24119049-24119071 TTTTGTATTTTTAATAGACACGG + Intergenic
1038177793 8:25197024-25197046 TTTTTTTTAAATAATAGACAGGG - Intronic
1038242048 8:25818884-25818906 TTTTGTATTTTTAATAGACAGGG - Intergenic
1039319890 8:36417507-36417529 TTTTGTATAAACAATTTAAAGGG - Intergenic
1039593858 8:38773153-38773175 TTTTGTATAATTAATAGAGATGG - Intronic
1040702203 8:50079734-50079756 TTTTGTATAAGTATAAGAAAGGG + Intronic
1040757173 8:50790776-50790798 TTATTGATAAATAATTGACAAGG + Intronic
1041177410 8:55210805-55210827 GCTTTTATAAGAAATTGACAGGG + Intronic
1041360432 8:57047175-57047197 GTTTGTATAAATAATGGAAAAGG - Intergenic
1043508666 8:80928400-80928422 TTTTGTATATTTAATAGAGATGG - Intergenic
1043509622 8:80936790-80936812 TTTTGTATTTTTAATTGAGAGGG + Intergenic
1043632818 8:82357747-82357769 TTTTGTATTTGTAATAGAGACGG - Intergenic
1043804342 8:84652488-84652510 TGTTGTAAAAGTTATTGAAAGGG - Intronic
1043953257 8:86333094-86333116 TTTTGTATACGTAATTTATGAGG - Intergenic
1044538685 8:93385907-93385929 TTTTGTATTTTTAATAGACACGG - Intergenic
1044987450 8:97767918-97767940 TTTTGTATTTGTAATAGAGACGG - Intergenic
1045051473 8:98331033-98331055 TTGTGGATAAGTAATTTAAATGG - Intergenic
1045841647 8:106588651-106588673 TTTTGTATTTGTAGTAGACAGGG + Intronic
1046181439 8:110654762-110654784 TTTTGTCTAAGTAATTCCCATGG - Intergenic
1046371566 8:113315887-113315909 TTTTGTATTTGTAGTTGAGACGG + Intronic
1046513578 8:115229376-115229398 TTTTGTATAAGGTATAAACAAGG - Intergenic
1047393308 8:124472021-124472043 TTTTGTATATTTAATAGACATGG + Intergenic
1047624835 8:126646084-126646106 TTTTCTATATGTAATTGAGATGG + Intergenic
1048757862 8:137757691-137757713 TTGTGTAGGAGGAATTGACATGG + Intergenic
1049559322 8:143300621-143300643 TTTTGTATTATTAATAGAGATGG - Intergenic
1050116874 9:2272134-2272156 TTTTGTATATTTAATAGAGACGG + Intergenic
1050171332 9:2821270-2821292 TTTTGTATTAGTAGTAGAGATGG - Intronic
1050196377 9:3088257-3088279 TATTGCACAAGTAGTTGACAAGG - Intergenic
1050202591 9:3161555-3161577 TTTTGTATTATTAGTAGACACGG - Intergenic
1051007338 9:12362153-12362175 ATTTGTATCTGTAATTAACAAGG - Intergenic
1051791336 9:20806099-20806121 TTTTTAATGAGTAAATGACATGG - Intronic
1052810753 9:33057159-33057181 TTTTGTTTTAATAATTTACAAGG - Intronic
1054882225 9:70155889-70155911 TCTTTTATAAGTCATTGACTTGG + Intronic
1054909748 9:70443313-70443335 TTTTGTATTATTAATAGAGATGG - Intergenic
1055987368 9:82064848-82064870 TTTTGTATTTTTAATTGAGACGG + Intergenic
1056573729 9:87838847-87838869 TTTTGTAGATGTACTTGATAGGG + Intergenic
1056607939 9:88102569-88102591 TTTTGTATTTTTAATAGACAGGG - Intergenic
1056993216 9:91430164-91430186 TTATGTATATGTAATTAATATGG - Intergenic
1057098163 9:92331350-92331372 TTTTGTATATTTAGTAGACATGG + Intronic
1057600447 9:96452053-96452075 TTTTGTATTTGTAATAGAGACGG - Intronic
1057627175 9:96687845-96687867 TTTTGTATAGGTAGTAGAGACGG - Intergenic
1058031100 9:100198459-100198481 TTTTGTATTTGTAATAGAGACGG + Intronic
1058691114 9:107521559-107521581 TTTTGTATTTGTAATAGATACGG - Intergenic
1058937416 9:109781619-109781641 TTTTTTAGAAGCATTTGACATGG + Intronic
1058948234 9:109878905-109878927 TTTTGTATTTTTAGTTGACATGG + Intronic
1059058200 9:111006531-111006553 TTTTGAATATGTAATTACCATGG - Intronic
1061369284 9:130188885-130188907 TTTTGTATTTGTAATAGACACGG + Intronic
1061440320 9:130598667-130598689 TTTTGGATAAGTAGTTTAAATGG + Intronic
1061553597 9:131352153-131352175 TTTTGTTTAAATAAGAGACAGGG - Intergenic
1061722446 9:132561041-132561063 TGTCGTTTAAGTAATTAACAAGG - Intronic
1062647677 9:137557333-137557355 TTTTGTATTTTTAATAGACACGG - Intronic
1185507421 X:641387-641409 TTTTGTATTTTTAATAGACAGGG - Intronic
1185686565 X:1933673-1933695 TTTTGTATTTTTAATAGACACGG - Intergenic
1185995195 X:4939235-4939257 ATTTGTTTAAGCAATTGATATGG + Intergenic
1186965366 X:14781257-14781279 TTTTGTATTTTTAATAGACATGG - Intergenic
1187141223 X:16595857-16595879 TTTTTTTTAAGGAAATGACAAGG - Intronic
1187513793 X:19946731-19946753 TTTTGTTTAAGGAATAGAAAGGG - Intronic
1187994980 X:24916449-24916471 TTTTGTATTATTAGTAGACAGGG + Intronic
1188129117 X:26408712-26408734 TTTTGTATTTGTAATAGAGATGG - Intergenic
1188339781 X:28985053-28985075 TTATGTAAAAGTAATTAACAGGG + Intronic
1188594378 X:31879462-31879484 TTTTACAAAAGTAATTGACATGG - Intronic
1188734523 X:33696114-33696136 TTTTGTATTATTAGTAGACAGGG - Intergenic
1188920619 X:35972400-35972422 TTTTGTATTTTTAATTGAGATGG + Intronic
1189358488 X:40329460-40329482 TTTTGTATTATTAATAGAGACGG - Intergenic
1190149045 X:47926680-47926702 TTTTTTAATAGTAACTGACAAGG - Intronic
1190181940 X:48199707-48199729 TTTTGTATTAGTAGTAGAGATGG + Intronic
1190186864 X:48242944-48242966 TTTTGTATTAGTAGTAGAGATGG - Intronic
1190187323 X:48246714-48246736 TTTTGTATTAGTCATAGAGACGG + Intronic
1190656212 X:52614486-52614508 TTTTGTATTAGTCATAGAGACGG + Intergenic
1190661520 X:52658647-52658669 TTTTATATTAGTAATAGAGATGG + Intronic
1190845505 X:54186969-54186991 TTTTGTATTTTTAATAGACATGG - Intergenic
1190851093 X:54242745-54242767 TTTTGTATATGTATGAGACAAGG - Intronic
1190892110 X:54579362-54579384 ATTTATATAAGAAATTGAAATGG - Intergenic
1192353495 X:70377763-70377785 TTTTGTATTTTTAATAGACACGG - Intronic
1193119997 X:77813290-77813312 TTTTGTATTTGTAATAGAGACGG + Intergenic
1193133558 X:77945019-77945041 TTTTGTATTTTTAATTGAAATGG + Intronic
1193489998 X:82137186-82137208 TTTTGTATTTTTAATTGAGATGG - Intergenic
1193796274 X:85878307-85878329 TTTTGTATTTGTAATAGAGACGG - Intronic
1194423097 X:93701349-93701371 TTTTGTAGAAATCCTTGACAAGG - Intronic
1194467298 X:94249011-94249033 TTTTTTATAATTAATTTGCATGG - Intergenic
1195263507 X:103157486-103157508 TTTTGCATAAGTAAATGGGAAGG + Intergenic
1195899069 X:109778607-109778629 TTTTGTATTATTAATAGAGATGG - Intergenic
1196068762 X:111495836-111495858 TTTTGTATTTGTAATAGAGACGG - Intergenic
1196399152 X:115295772-115295794 TTAGGTAAAAGTAATTAACAGGG - Intronic
1196852388 X:119949742-119949764 TTTTGTATTATTAATAGAGACGG + Intergenic
1197599450 X:128510457-128510479 TTTTGTATTTTTAATAGACAGGG - Intergenic
1197985533 X:132262776-132262798 TTGTGTATAAATAATTTAAAAGG - Intergenic
1198531422 X:137552067-137552089 TTTTGTATTTTTAGTTGACATGG + Intergenic
1198704016 X:139427722-139427744 TTTAATATAAGTAATATACAAGG - Intergenic
1199291261 X:146107118-146107140 TTTTGTCTAAATAATTGTAACGG - Intergenic
1199353137 X:146828647-146828669 TTTTGTATATTTAATAGAGACGG + Intergenic
1199385062 X:147214164-147214186 TTTTGTATTTGTAGTTGAGATGG - Intergenic
1200957356 Y:8964066-8964088 TTTTGTATTTGTAGTAGACACGG - Intergenic
1202339830 Y:23852032-23852054 TTTTGTATTATTAGTAGACAGGG + Intergenic
1202348426 Y:23959874-23959896 TTTAGTATAAGTGATTTACAAGG + Intergenic
1202522348 Y:25710230-25710252 TTTAGTATAAGTGATTTACAAGG - Intergenic
1202530936 Y:25818050-25818072 TTTTGTATTATTAGTAGACAGGG - Intergenic